TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'retro-NXF5'. The HGNC name for this gene is 'retro-NXF5'.

2 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
MALAT1 retro-NXF5 17311249 gagctgaaattgtgccattgcactccagcttgggtgacagagattatatgtcatacctcc
MALAT1 retro-NXF5 17311249 gctccttggtgaattgataagAgtgcaatggctgttcacaggcacaatcatggtgc

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)