TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'WT1'. The HGNC name for this gene is 'WT1'.

3 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
EWSR1 WT1 16730884 AGCCAGCAGCCACTGCACCTACAAGgTGAAAAGCCCTTCAGCTGTCGG
EWSR1 WT1 16730884 gcttatccagcctatgggcagccagcagccactgcacctacaagctgaaaagcccttcagctgtcggtggccaagttgtcagaaaaagtttgcccggt
EWSR1 WT1 S79672 AGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTGAGAAACCATACCAGTGTGACTTCAAGGACTGTGAACGA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)