TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'USP6'. The HGNC name for this gene is 'USP6'.

9 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CDH11 USP6 AY380223 TTCGTGTTGTCATTTGTTGAGTGACCAATCAGATGGGTGGAGTGTGTTACAGAAATTGGCAGCAAGTATCCAATGGGTGAAGAAGGAAACTGGGCATCTCTGTGGCCCTGAACATCCCAGGAGGCCGATCGTACAGAGACCTCTGGTGCCTGACCGCAGTTCACATCCACATCCCTGGAATAGACCATCACAGGCTCTTCACCCTTGGCA
CDH11 USP6 AY380224 TTCGTGTTGTCATTTGTTGAGTGACCAATCAGATGGGTGGAGTGTGTTACAGAAATTGGCAGCAAGTATCCAATGGGTGAAGAAGGATGGACATGGTAGAGAATGCAGATAGTTTGCAGGCACAGGAGCGGAAGGACATACTTATGAAGTATGACAAGGGACACCGAG
CDH11 USP6 AY380226 GTGAATGGGACCGGGACTGGGGCCGGGACTGACACCGCAGCGCTTGCCCTGCGCCAGGGACTGGCGGCTCGGAGGTTGCGTCCACCCTCAAGGGCCCCAGGAAACTGGGCATCTCTGTGGCCCTGAACATCCCAGGAGGCCGATCGTACAGAGACCTCTGGTGCCTGACCGCAGTTCACATCCACATCCCTGGAATAGACCATCACAGGC
CNBP USP6 AY624556 GTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCCGTCTTCCCCAGGCCTGCGTCCGAGTCTCCGCCGCTGCGGGCCCGCTCCGACGCGGAAGGATGGACATGGTAGAGAATGCAGATAGTTTGCAGGCACAGGAGCGGAAG
CNBP USP6 AY624557 GTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCCGTCTTCCCCAGGCCTGCGTCCGAGTCTCCGCCGCTGCGGGCCCGCTCCGACGCGGAAGGAAACTGGGCATCTCTGTGGCCCTGAACATCCCAGGAGGCCGATCGTACAGAGACCTCTGGTGCCTGACCGCAGTTCACATCCACATCCCTGGAATAGACC
COL1A1 USP6 18068538 AGGAAGGCCAAGTCGAGGGCCAAGACGAAGACAgatggacatggtagagaatgcagatagtttgcag
COL1A1 USP6 AY624558 CCCAGCCACAAAGAGTCTACATGTCTAGGGTCTAGACATGTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGCGGCCACCGCCCTCCTGACGCACGGCCAAGAGGAAGGCCAAGTCGAGGGCCAAGACGAAGACAGAAACTGGGCATCTCTGTGGCCCTGAACATCCCAGGAGGCCGATCGTACAGAGACCTCTGGTGCCTGACC
OMD USP6 AY624560 ACTGTGGATTTTTAAGAGACTCAGTTAAAGAATTTAGGAATTTCTGATTCATTTAAAGGATTTACAAATTCATCAACCCCTGAAAACTAAAGCAAATTGAACAGGAAACTGGGCATCTCTGTGGCCCTGAACATCCCAGGAGGCCGATCGTACAGAGACCTCTGGTGCCTGACCGCAGTTCACATCCACATCCCTGGAATAGACCATCAC
THRAP3 USP6 AY624559 GAGGTTCGGGCTGGTTGTTCCGTTGCGAGCTGCAGCTGCGATCTCTGTGGTAGGCCCAGGAAACTGGGCATCTCTGTGGCCCTGAACATCCCAGGAGGCCGATCGTACAGAGACCTCTGGTGCCTGACCGCAGTTCACAT

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)