TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'TMPRSS2'. The HGNC name for this gene is 'TMPRSS2'.

22 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
TMPRSS2 ERG 16254181 agcgcggcagGaagccttat
TMPRSS2 ERG 16575875 CGCTGGCCTACTCTGGAAGTTCagAACTCTCCTGATGAATGCAGTGT
TMPRSS2 ERG 16575875 CGGGGAGGACGAGAATCGGTGTggAAGCCTTATCAGTTATGAGT
TMPRSS2 ERG 16575875 GCAAGATGGCTTTGAACTCagAAGCCTTATCAGTTGTGAGTG
TMPRSS2 ERG 16575875 GCGCCGCCTGGAGCGCGGCAggAAGCCTTATCAGTTGTGAGT
TMPRSS2 ERG 16575875 GCTGGCCTACTCTGGAAGTTCagAAGCCTTATCAGTTGTGAGT
TMPRSS2 ERG 16951141 agcgcggcagCcgtcaggtt
TMPRSS2 ERG 16951141 agcgcggcagGaactctcct
TMPRSS2 ERG 16951141 agcgcggcagGaagccttat
TMPRSS2 ERG 16951141 agcgcggcagGttattccag
TMPRSS2 ERG 16951141 tgcacctcaaGaagccttat
TMPRSS2 ERG 16951141 tttgaactcaGaactctcct
TMPRSS2 ERG 16951141 tttgaactcaGaagccttat
TMPRSS2 ERG 16951141 tttgaactcaGttattccag
TMPRSS2 ERG 17032499 aactgataaggcttcCtgccgcgctccagg
TMPRSS2 ETV1 DQ204770 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGCTCAGGTACCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTT
TMPRSS2 ETV1 DQ204771 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCACTCAGGTACCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTT
TMPRSS2 ETV1 DQ204772 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGTCCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGCAGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCCTAGCCAGGTGAATGGCTCAAG
TMPRSS2 ETV1 DQ204773 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTTATTCCAGGATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTCACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAG
TMPRSS2 ETV4 18794152 caagatggctttgaactcaGtctcggcccccgcttggggcccc
TMPRSS2 ETV5 18172298 agtgtgcacctcaaGaggatcccttttcccc
TMPRSS2 ETV5 18172298 ccgcctggagcgcggcagGaggatcccttttcccccagaa

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)