TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'TCR'. The HGNC name for this gene is 'TCR'.

16 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BCL11B TCR 15668700 GAAGGAAAGAAAGAAAGAAAGAAAGAAAGGGAaataaagaaattaaa
LCK TCR S72854 TGCCTTCGGTTCGGGGACCAGGTTAACCGTTGTAGGTAA
LCK TCR S72855 TGTTTTTGTACAAAGCTGTAACATTGTGGGGACAGGGTGACGGGTGGCTGCGTGAGAGACCCTCTTCTAA
LYL1 TCR 2752424 CCAGGCTGCAAGAACAGTGCTGGgGTAAGAGGGGAGCGGGGGATCCCGGG
NOTCH1 TCR 1831692 GACATGCCTGCCCACCCTCGCAGGATCACGGCAGAGAGTCCC
PVRL2 TCR 17696193 TGGCCGCTGCTGCTGCTGCTGCTCCTGGAAACCGaTATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAG
RANBP17 TCR 12399963 TATTAAAAAGGCAAAAAGAGCAGATGTTGTCAAGGATGCAGAGAAAAGGAa
TAL1 TCR M25747 ATGAGCTGGGCCGGAGGGTCAGGAAACCCAGTCGCCCTTACTTCTTGCCCTGGGGATCAAAGTTCTGCTTTCTCCCCAATGAGACTTGCCTTCCTAAGCCTGTGGCTGTGGAGACCATGTCTGCAGCCCTGAGTCTTG
TAL1 TCR S65910 GTTTTTATACTGATGTGTTTCATTGTGGGTGCGTCACACCGCAGCGTAACTGCAGGCCTCTCAGCGAAAAAGGGAAAG
TAL1 TCR X58618 TTTGGGCGCGGCAGATCGCCCAGGACGTTAAAGAAGACGTAGGCCCCGTTACTGGGGGATACCCGATAAACTCATCTT
TCR CMC4 11054065 cTCCCTGGACCACTTCCGGTTGCCGGCCCGCGCCTCATAACTTCGGTTCGAGTGACCTCGGCCCGGGATGCCCCTCGGCTCACCCCGGGCTCACGTCGCGATCCTGGCTT
TCR LMO1 2034676 cACAGTGGCTCACCACCCCACACAGCCCTCACTCTGGCATGCGGACACACACA
TCR LMO1 2501659 CACAGTGGCTCACCACCCCACA
TCR LMO2 1281693 GGTTGAGCTGGTGACTGCTGTGGGT
TLX1 TCR 2326274 CCGTGGTGCTGCGGGGCCAGgga
TLX1 TCR 2542965 TCTGTCTCGGCTTCTGGCCTTCCTCTCCCCCTCCCCTCCCCTCCCCTCGCGCTGTCATTCACCCCGCTc

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)