TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'SS18'. The HGNC name for this gene is 'SS18'.

15 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
SS18 SSX1 AF404831 AACTTCAAGCCATTCATTAAGCAAATGTTTATTGAGCAACCATTATATGCCAAGTGCCATGCTAAGATTGGGAACATATTGGGAAATAAGATAGACATGGACTCAGTCTTTATGAACTTAAGTGTAGATGGCATACAGGTGGGTAAACAGCTGGCCTCTGCTCTGTTACCGGGGCCACTCCCATGGCTTAGGAATCGCTTTGACTGTTGGCCCCTCCTTGAGCTCCTTGAGGGCTTTGTCTGCACCTGGGGCATCCGAGAAGCCCCAGTCCCAGCCCAGG
SS18 SSX1 AF500624 TTCATGTTTGTATTTGTTTATGAAGTTCAGATGGAGCTTCTAACTCAGATCTTGAGAAATATTCCTTCGG
SS18 SSX1 AY138487 ATTGTTTTGAACATATGGAATACAAATATAATTCTTTTAATATCCTCTTCTGCCAACTCTAAACACTCTATCACAACAACTTATGTAGCACCGACGGCTTGATAATACTAACAGTTGTGATCCTTAATACTTCTTTTGTT
SS18 SSX2 17509396 ttatggatatgaccagAtcatgcccaagaagccagca
SS18 SSX2 AF404832 TTTTTTCTTTATGGATTATGCTTTTGGGATCATGTGTAAGAAATCTTTACCTAACTGAAGGTCACAAAGATTTTCTCCTGTACTTTGTAACCAGAATTGGTATGGGTACCACCTCACTGAATTCCACATTGAATGTCGGTGCCCCAGTAGGGTAGTATGTCATATCTGGTACTGCTTTGTTTGCTGCCTAGATTAATTTCGGCAAACCAT
SS18 SSX2 AY138488 TGTAGTTCAGTAAAGCAGAAGCATGGGGAAGAAGAGACAAGACTGGAGAGAGGTGTTGGAGTTAGCTTAGGAAGGCTCTTACAAGCCGTATTAGGGGACTTGAACTTTATACTCTTCTCCAAATCATCTGTATATCACACTCTCAATTACATGGAGATTTTTGCTGTTTGCAAGAATGTCAGTCCTAAAAGAGTGGGAAGATAAGCATTC
SS18 SSX2 AY138489 ATGCAGTGGTAACTAGAATTTGAGGCATGAGCAGTTCTTTGATCAGCCCTCTCTCATGCCTACAACCATAGGGCCTGCTGGTGCTTCCAATGAGACACCCACTCTCTCAACAGGAAGGACCATCTGGTCTCTGCTGTGTT
SS18 SSX2 AY138490 GGAACATATTGGGAAATAAGATAGACGTGGACTCAGTCTTTATGAACTTAAGTGTAGATGGCATACAGGTGGGTAAACATATGATATGATACAGTGTGATAAGTACTTAGATAAGGAAAGCTCCATGTGACTTGACACAAATCTTCTAAGTTCTCTGAGCTCCAGATTCCTGGTCCATGAAATGGAAGTAAAGAATTATAGTTCATGTTTTAGATCATAGTTATCAGCAACATAATAATAAAATGAGGCTATCGTGGTACAGAGATGTTAAAGAATTTTCCTGGGGCGCAGTGGCAGTGGTAGTCTAATCCAGAGCTCCAAGCCATTTAAAGCTCATTCACATTTGCATT
SS18 SSX2 AY138492 CATTCATGGACAAGTCCCTGGGGACATTTTTCTTGGGTAAATACCTAGGAGTGGAATGGTTGGATCATATGATAGGTATATATTTAATTCAACAAACTGCCAGAATGTTTTCCGAAGTAGTTGTACCATTGTATATTCCTATCATTTTACATTCTTACCAGCAGTGTATGATTTCACCCATATCCTTGCTAACTCATTGCCAATATTTGGTATGAATCAGTCTTTTAAATTTTATTTATTCTAATAGGTGTAGTCCTAAAAGAGTGGGAAGATAAGCATTCTATCCCTGGAAACCATATTCACTTAGGCCATTCCTTTCCCTTCTAACCTCCCCTCCCAGGTTTCTCCTA
SS18 SSX2 AY138493 ACTTTTTAAAAAGTGAGATTCTGTCCATGTATTCCATCACTCAACAAATATTTATTCTCCATGTGTTTGATACTGCAGTAGGTCCTACGGAGGTAAAATAGTCAACCAGCTGTCTTGATCTTCCTTGACCTCACTTTAGCTATTGGCACATTTGCATTTGTCTATGAAGTTCAGATGTTGCTCACTAGGGCTTCACCCCATAGGGCCTGCTGGTGCTTCCAATGAGACACCCACTCTCTCAACAGGAAGGACCATCTGGTCTCTGCTGTGTTGCTGGGGC
SS18 SSX2 AY138494 CCATATGAAAGCCATGTGACTTGACACAAATCTTCTAAGTTCTCTGAGCTCCAGATTCCTGGTCCATGAAATGGAAGTAAAGAATTATAGTTCATGTTTTAGATCATAGTTATCATTAGATGGTCTTCTTTAGTTTCTATATTTCTGAAACATTTTGTTCCTCTCGCGTTTACATTGATTCATTCTTTATTGTTTTTATTGGTTTTCCTTTTTATTTTACCCTAATATCAATTCTTGACTCTGTATTTTTTTTTCTAGCCTCTGAATCATACTGCCCTCTATTTTCAGTATTCTTAGCTCTTACTTCTCAACCCAGTTTCAGCTCCTTTTTATCCAAATGTACAGAACAT
SS18 SSX2 AY138495 ATTTAATCCTTAAGAAGACATTGTTTCTATTATCTCCAAATAATCTAACTCAGATCTTGAGAAATATTCCTTCGGAAATATTATATATAAGTGTGAAGTACCAAGGATGAGCCAATATTAGCCAGGTAGATGTGGATGAT
SS18 SSX2 S79894 CCTTATGGATATGACCAGTCTCCTTTCATGTGTAATAAACGGGCCGAAGACTTCCAGGGGAATGATTTGGATAATGACCCTAACCGTGGGAATCAGGTTGAACGTCCTCAGATGACTTTCGGCAGGCTCCAGGGAATCTCCCCGAAGATCATGCCCAAGAAGCCA
SS18 SSX4 AF257500 GTGGTCCAGGTCCTCAGTATCCTAACTACCCACAGGGACAAGGTCAGCAGTATGGAGGATATAGACCAACACAGCCTGGACCACCACAGCCACCCCAGCAGAGGCCTTATGGATATGACCAGATCATGCCCAAGAAGCCAGCAGAGGAAGAAAATGGTTTGAAGGAAGTGCCAGAGGCATCTGGCCCACAAAATGATGGGAAACAGCTGTGCCCCCCGGGAAATCCAAGTACCTTGGAGAAGATTAACAAGACATCTGGACCCAAAAGGGGGAAACATGC
SS18 SSX4 AF257501 CCCAGGACAGCAGCAGGGCTACGGTCCTTCACAGGGTGGTCCAGGTCCTCAGTTTCCTAACTACCCACAGGGACAAGGTCAGCAGTATGGAGGATATAGACCAACACAGCCTGGACCACCACAGCCACCCCAGCAGAGGCCTTATGGATATGGCCAGGACCCAAAAGGGGGAAACATGCCTTGGACCCACAGACTGGCGTAAGAGAAAGCAGCTGGTGGTTTATGAAGAGATCAGCGACCCTGAGGAAGATGACGAGTAACTCCCCTCGGGGATATGACA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)