TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'RUNX1'. The HGNC name for this gene is 'RUNX1'.

61 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
ETV6 RUNX1 AF044317 GTGTATATATGTATATATGTGTGTATATATGTATATATGTATATGTGTATATATATAATCTTGCCAAATACTACAAATTTTATAAATCGTTCCTTTACTGGCTGTTTGGTGATATATCTTTTATATGC
ETV6 RUNX1 AJ494735 CTTGTCGAAGCCACAGCACAGTACCTACAAATAGCACCCACTGAGAGTAAAATGTTTACTAAGCATTCCTAAATTTTAAAAAGATTAATTTTAAAATGTCCTCAGCTTGCTACTTGTGAGGACACAATGGGTTATGAAGT
ETV6 RUNX1 AJ494736 AGCCACAGTTCCCACAGTCAGAGTCACCAAGCCACATAGTTTTTCTTTTCCCACCATTTTTCACTTCTTTAGAATTATAAGATAAGCCTGTTACATATCCTGAATCATTGGTCCCATTCTATGTATATGCAAAAGAAGTT
RUNX1 AFF3 17968322 AGTCGACTCTCAAagaaaggtgatgc
RUNX1 CBFA2T3 17126398 atcacagtggatgggccccgagaacctcgaaTgatgaacggcagcagccactcaccaacagccatcaat
RUNX1 CBFA2T3 9596646 ATCACAGTGGATGGGCCCCGAGAACCTCGAAtGATGAACGGCAGCAGCCACTCACCAACAGC
RUNX1 CBFA2T3 9596646 ATCACAGTGGATGGGCCCCGAGAACCTCGAaCCCCAGTGGACAGGAAAGCTAAGGCCTCAG
RUNX1 CBFA2T3 9596646 TGGTCTATGGTCTGTCTCtGACATCGGCAGAAACTAGATGAT
RUNX1 CLCA2 20875871 ccctcagcctcagagtcagatgcaggGtggttgaattttgtaatgcaagtaccca
RUNX1 CLCA2 20875871 cctttaaccctcagcctcagagtcagatgcaggGaaatgataactgaagcttca
RUNX1 CLCA2 20875871 cctttaaccctcagcctcagagtcagatgcaggGtgttcatctgacatcacaggcatttt
RUNX1 KIAA1549L 23102734 cctcagagtcagatgcagGtgccagcgagtgacgaagag
RUNX1 KIAA1549L 23102734 gggccccgagaacctcgaAtgccagcgagtgacgaagag
RUNX1 LPXN 19760607 agtcagatgcagGgactgcttcac
RUNX1 LPXN 19760607 agtcagatgcaggGactgcttcac
RUNX1 LPXN 19760607 agtcagatgcaggGctttcatgag
RUNX1 MACROD1 17532767 cctcagagtcagatgcaggCctttctgaagggcctgagt
RUNX1 MACROD1 17532767 gggccccgagaacctcgaaCctttctgaagggcctgagt
RUNX1 RUNX1T1 18206543 ccccgagaacctcgaaAtcgtactgagaagcact
RUNX1 RUNX1T1 AY152436 GACCCTGATTCTTCTTTATGAGTGAAAAGCTTGAGAACACTTTCCTGTATATTTAGACATTTA
RUNX1 RUNX1T1 AY152437 TATGCTGTGTACCTGTATAAAGAGGTTATTAAACCTCTTGGCAGTCAGAGGGGAAAAAAGATG
RUNX1 RUNX1T1 AY152439 GCTTAACTGTACTGAAATCCATTACAGAGATGAGGTGAAATCTCACTCTGTTGCCCATGCTGG
RUNX1 RUNX1T1 AY152440 ATTGTATGACATGCCATAAGAAAAAAAAAACCCGGACTATGACAGTGTTTTGTACTGGAGAAC
RUNX1 RUNX1T1 AY152441 GGGATATATTCTAGTTTTATAAAATATGATATCACTAATTTGAATGCCACACCAGTGAGGTC
RUNX1 RUNX1T1 AY152442 TACTTTCATCTTCATTTTCCTCTCCTGTGAGACCTTGTTTTCCATGTGGCATTAAAAATTTA
RUNX1 RUNX1T1 AY152443 GTATGTGTGGTGTGTGTACATACTTTAAACATAGCAAAAAGGGTAACAAAATATGGTCAGC
RUNX1 RUNX1T1 AY152444 CTTGAAATCCTTCTGGAAATGAGAAAACTTTAGAAAGTACAGTCGTAGAGTCCATTA
RUNX1 RUNX1T1 AY152446 ACTTTTAGAAATTTTACCTTTTTCCAAAAATAAAAAAATAGGGAATAAATATTGTATAT
RUNX1 RUNX1T1 AY152447 TTGAATTTATTTAAAGATATCTGGGATACCCTTTTTAAATGTTGGAAACAAAAGAAGTAA
RUNX1 RUNX1T1 AY152449 GAAACATAATAAACCAGATCATAGATCAAGGGGGGGGCAGCGGGCAGGCTGTTTCTCAATCTG
RUNX1 RUNX1T1 AY152450 TTGTTTTGGTGAAGAGCATGATGAGGACACTTGCTATAAAAATGTTTGTAGGCTGTTTGGGAT
RUNX1 RUNX1T1 AY152452 TATAGCAAACCTATTATATATGTGAACATGAGAAATACTATCCTTAGAATTCCCAGGCTCCA
RUNX1 RUNX1T1 AY152453 AGTATGATTGACACATGGTATTACAGCTCCTTTGAATTAACTCACTTAATACCCACTGT
RUNX1 RUNX1T1 AY152455 CTGCATGATACCTCTCTTGCTAGGGGATGTTTTTTATGAACGAAAAGTTATTCTGTCTGAGTA
RUNX1 RUNX1T1 AY152457 GGCCTGACCTGGTGGAAAGACTGCGGGCCTGCCCGCAGAGTCCATTATTAACTTACTTT
RUNX1 RUNX1T1 AY152458 GGAAGTCATTATTTAAAATATTTTAACATTGGAATCCGAACTGGAAACCACTGAAATTTGAGT
RUNX1 RUNX1T1 AY152459 GTGACATGCTCTAAGTAGGGGAAATCTTCCTTTATATGTGGGCATAGATTTTGATAATTTG
RUNX1 RUNX1T1 AY152460 CTCAGTTGGCGTCTGTGACAGGAGAGATGCCCCCTAGATTTTCCTCCCCCTGATTTCTTC
RUNX1 RUNX1T1 AY152462 GCCACGAATTCCTGGGCTCGAGCAATCCTCCCAGGGCTCACTGTCCATTTCTGTCTGGTGACT
RUNX1 RUNX1T1 AY152463 TGTGTCTGTATGTGTTTACATGCATGCCTGTGTTGGGTTGTCAGAAAACAACTTATGTATTTG
RUNX1 RUNX1T1 AY152464 TTTGCTTTTGTGGGAGCCCAGCATTTTGTTTTTGCTGTGTGTGTGTCCAGGTGTCTGTGTATG
RUNX1 RUNX1T1 AY152465 TCGCTCTGTCGCTCAGGCTGGAGTGCACTGGCATGATGAATATAATCAAGTTCATCAAGAATT
RUNX1 RUNX1T1 AY152467 CAAAATCATTTATTTCTTGGTGAGCCTTCTTTCCATTGTCATAAAACAGTAGCAAATCAAAGG
RUNX1 RUNX1T1 AY152468 TTTTCAGACCTGCCCTCTTCCTGTAACCCATTCCTTTTTTATTATACAATTTGGATGTTAGAG
RUNX1 RUNX1T1 AY152469 CATTCACTTGCATAAATGCATTCATCATGTTGCCGCCCTGGCCGTGTGAGATTGGGCAAATGA
RUNX1 RUNX1T1 AY152470 AAAGGCAGCTCGGGTATCAACGAGATATGCCCATTGATATAAAAGCAAATATACTATGCTGGG
RUNX1 RUNX1T1 AY152471 GTACAATAATCCATAATTTTAATAAGATTATAACATTCGGGGGGCAAATGAGCCTTTTAACTG
RUNX1 RUNX1T1 AY152472 TCTTCTTTACCCCAACTCGTAATGCCAGGCATAAAGACACTCTAATATTTTATTCTGTAGACA
RUNX1 RUNX1T1 AY152473 AAGGCATTGGCACTATCAGAAACAATTTGTAAAGTTTGATCATCAGGAAGCCAAGGATCTATG
RUNX1 RUNX1T1 AY152474 GAAGCTCACCAGATAGGCTGTAGCTACCTTTGTTTTTTGGACAAATACTATCCTTAGAATTCC
RUNX1 RUNX1T1 AY152475 AAATATTATGCCAAAGTATGATGATGATGACTCACTCCAGTGGGCCTATTNTGCTGGGAATAT
RUNX1 RUNX1T1 AY152476 CCACACCAGTGAGGTCAGGATCTAAACAGATCTAAGAATTTGGCTCTATTTTACACTTCTGG
RUNX1 RUNX1T1 D14822 AAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAATCGTACTGAGAAGCACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACGCAATCTAGGCTGACTCCTCCAACAATGCCACCTCCCCCAACTACTCAAGGAGCTCC
RUNX1 RUNX1T1 S45790 GCCCCGAGAACCTCGAAATCGTACTGAGAAGCACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACG
RUNX1 RUNX1T1 Z35296 AAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAATAAACCCCACTTGAAAAACTGAGGTGCTTAAGGAGTAAAATAATATGTTCCTG
RUNX1 SH3D19 16858696 CAGAGTCAGATGCAGgaTCGCAACGAACGAAAT
RUNX1 SH3D19 16858696 CCCCGAGAACCTCGAaaTCGCAACGAACGAAAT
RUNX1 TRPS1 17244685 cagatgcaggAtatggtccggaaa
RUNX1 USP42 16357831 GGAGTGGTAATGGTATTCCCTGACATTCGCTCATttGAACTCTCATGTAGCCGTCAACCAACTTTGACA
RUNX1 YTHDF2 16858696 CCCCGAGAACCTCGAAagAACGTCAAGGTCGTG
RUNX1 ZNF687 16858696 GAGGTGCTGGCCGACcgTCTGCTCTGGGTGGGTG

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)