TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'RET'. The HGNC name for this gene is 'RET'.

26 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CCDC6 RET 10931090 CCCGAGTAGCTGGTATTACAGGCACACGGCACCACACCTGGCTGCTTTTTGTATtATCTCCTCAGCTGAGATGACCTTCCGGAGGCCCGCCCAGGCCTTCCCGGTCAGCTACTCCTCTTCCGGTG
CCDC6 RET 2406025 TGCAAGGCACTGCAGGAGGAGAACCGCGACCTGCGCAAAGCCAGCGTTACCATcGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCTAGGAGAAGGGGAA
GOLGA5 RET 9443391 CAGCTCAGATCCGAATTACAgGAGGATCCAAAG
HOOK3 RET 17639057 caagagacagGaggatccaa
KIF5B RET 22194472 gtcagcttcgtatctctcaaGaggatccaaagtgggaatt
KTN1 RET 10850414 ATCTTTCTAGCAAAACACAGCTGTTACAgGAGGATCCAAAGTGGGAATTCCCTCGGAA
NCOA4 RET 10597232 ATCATGGCAGGCTTtATTCTGCTTACGCTT
NCOA4 RET 10597232 CAGTCCCAAGTGGGCtGAAGCTGGGAGGCA
NCOA4 RET 10597232 CATCGGGCAGGGGAgTTTTTTAGTAGATACGG
NCOA4 RET 10597232 GAAAGTTTAGAAAAtAGAGACAGGCAGGTTC
NCOA4 RET 10597232 GCCTTCCCAGATGTGgTTTGATGACTTGCCT
NCOA4 RET 10597232 GCTGGGCAGACGAGGgAGGCAGAGCTTGCA
NCOA4 RET 10597232 GGCTTTGGCCTCCCtAGATTCTAATTCTGC
NCOA4 RET 10597232 GGTGTGAGCCAAGGaAGCTGGCGTGGTGG
NCOA4 RET 10597232 GTGGTGGCCTGCCcTCCTGCCTCAGCCTCC
NCOA4 RET 10597232 TCGAGACCATCCTGgGGGGGCCAGGGTGGG
NCOA4 RET 10597232 TGTCGACACTGACCTTgAATACAAAAAAAAAAA
NCOA4 RET 10597232 TTCCTACTAGCACTGtTGATCTGCCTGCCTC
NCOA4 RET S74821 AAATTTCAAAACACTGGGCAAGACAGTAAATATGCAGACAGGGCCCTGCCCCTTCAGTGTTCCTACTAGCACTGTCCAGG
NCOA4 RET S74825 TCCTGGCCAGGCAGGCCTCTGCCCTCTCCTGGTGGTGGCCGGGCCGGGCGTGGTGGCTCACGCCTGTAATCCCA
NCOA4 RET S83049 ACCCATCTCCTCAGCTGAGATGACCTTCCGGAGGCCCGCTGTAAAGGCATATTACACCCTTTTCTATCAGATAAGAGTA
PCM1 RET 10980597 AAAGCAATTATGAAAGAAGTCATTCCTTTTTTGAaGGAGGATCCAAAGTGGGAATTCCCTCGGAAGAAC
PRKAR1A RET 7678053 CCGAGACAGCTATAGAAGAATCCTCATGgAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGT
PRKAR1A RET L03357 GGAACACCGAGAGCAGCCACTGTCAAAGCAAAGACAAATGTGAAATTGTGGGGCATCGACCGAGACAGCTATAGAAGAATCCTCATGGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCTAGGAGAAGGCGAATTTGGAAAAGTGGTCAAG
TRIM27 RET 12787916 caccagggagctcctgcagGaggatccaaagtgg
TRIM33 RET 10439047 GAGAACCAGGTCTCCGTGGATGCCTTCAAGATCCTgAAATGTGAACGTCTTCTGCAAA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)