TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'RARA'. The HGNC name for this gene is 'RARA'.

43 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BCOR RARA 20807888 aaaagttcttaacagCcattgagacccaga
FIP1L1 RARA 17301809 catttccatatggcaAtgccattgagacccagagca
FIP1L1 RARA 18603554 tctgcacgtgcatttccatatggcaatgCCATTGAGACCCAGAGCAGCAGTTCT
FIP1L1 RARA 21750086 caccaccggCcattgagacccaga
NABP1 RARA 23287866 ATGGGTACAGGTACATTTGGACCAGTGgcCATTGAGACCCAGAGCAGCAGTTCTGA
NPM1 RARA 9989813 GGGCCAGTGCATATTAGTGGACAGCACCTTAGTAGCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTA
NPM1 RARA 9989813 GGGCCAGTGCATATTAGTGGACAGCACCTTAGTAgCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTA
NUMA1 RARA 9288109 GCCCACCACTCCGCAGTTCTGCTCGTCGTTCCCAGGCCGGGGTGTCCAGTGGGGCCCCTCCAGGTGAGGGACTTCtTAGACTCAGTCTAGAATATGTGGGCCAATGCCACCACCTTGGAAGGGTCCCTTGGGTGTGTGGAAGTCCGCTGGTGACTGG
NUMA1 RARA 9288109 TTCCCAGGCCGGGGTGTCCAGTGGGGCCCCTCCAgCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCC
PML RARA 12508246 AACTAAATGAAGCGTCTTTtAGCGTGGGTGTGCATATATA
PML RARA 12508246 ACCTCACGTGGCCAGTGGCgAGTTGCGGTTAGGCCACGGT
PML RARA 12508246 AGGTAGGGAGGTGGGTAGGGaGGAAGGCTGGCTGGAACCC
PML RARA 12508246 ATCTTCTATGAACACTGCCaCCAGCCA
PML RARA 12508246 TAAGGCACAGCAAGAAATTaAAAGCCACAGTTCTTATTCT
PML RARA 12508246 TCCACCTAGGTAGTGAATGtTCTTGACATTTGATGGAAAT
PML RARA 17454588 agctcttgcatcacccaggggaaagCcattgagacccagagcagcagttctgaagagatagtgcccagc
PML RARA 17454588 atcaaaggcccttcctatggagagCcattgagacccagagcagcagttctgaagagatagtgcccagc
PML RARA 17454588 gtggccagtggcgccggggaggcagCcattgagacccagagcagcagttctgaagagatagtgcccagc
PML RARA 17960172 AGTGGCGCCGGGGAGGCAGcCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATA
PML RARA 19100514 tgccacctggagaccgagatctgcaggagaaaggcctgggaaaaATCTtccctcgccaccccctctaccccgcatctacaagccttgctttg
PML RARA 20633765 ccaagcacttcaggaggttctcttaagcCagctgctctgctcggat
PML RARA S57797 GGGGTACCCAGAATAATGGGCTTTTGGGGCCCTGGGGACTAACGCGTTGTGGTGATCAGCAGCTCGGAAGACTCAGATGC
PML RARA S76369 AGTGAGGTCTTCCTGCCCAACAGCAACCACGTGGCTGCCAGCAGTGGTGAGGCTG
PML RARA S76370 GCTGGGGAGTCCCAGTTTTCGGGGAGGCAGGTAGGGAGGTGGGTAGGGCAGTGGC
PML RARA S76372 CCGGACATAGTATTGAGGCCAGACAGACAGGGAGGCAGGTAGGGAGGTGGGTAGG
PML RARA S76373 CATGACCTTAACTCTGCTCTCTCAGTCTGCCCCTCCCCTCTTCTCTCTCTAGCCA
PML RARA S76375 CTTCTATGAACACTGCCAGGCTGGTAGTCAGCCCCTGGTGTTCCCATGCTTCCTT
PML RARA S76379 GTAAGGGGGGAGGGTGGTAGCACATAGTAGTTGGGCAGGAGTTGAGGTTAACCCA
PML RARA S76382 GTCCCTCATTCTGACTGAGCCCTAGCCTTTCCCTCCCTCCTCTTCAAGCGTTAAC
PML RARA S76387 GTTTCCTCTGCCCCCAGCTTATGTCCCTTGGTCACACACTGAGCACTGACTGATA
PML RARA S76389 CAAATGCTATTGGTAATCGATGGGTTCTATTGTTACTGCTTTTACGTCTTGGAAA
PML RARA S76395 CCCCTCCCCCCACCAGTCTGGATTGTCTAACTAAATGAAGCGTCTTTAACTCTAG
PML RARA S76399 TCAGGAGAGAATCTGCTGGGCTGGGGATGGCCAGGTAGCAGTTGTCAGGCCTCCT
PML RARA S76402 ACAGCAAGAAATTATGGAAACCCATTTGTGTTGGAGTGAAGAGCAGACGGCGGTG
PML RARA S76405 TGGGAGAAAACCAGGCCAGGGCAGTTGATTTGTGAATTACTCAAATCCAAATGCA
PRKAR1A RARA 17712046 CAAGGGAGGATGAGATTTCTCCTCCTCCACCCAACCCAGTGGTTAAAGccattgagacccagagcagcagttctgaagaga
PRKAR1A RARA 17712046 GCACTCGTACAGACTCAAGGGAGGATGAGATTTCTCCTCCTCCACCCAACCCAGTGGTTAAAGCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCT
STAT5B RARA 10441338 GTAGTGGTAACGAACCTTCAAACTAAGAgGGTACTCTGGGTCTCGTCGTCAACT
STAT5B RARA 10441338 TGCCACCACACTTGGcGGGCAGGCCGCCCAGGGGCAGG
STAT5B RARA 18221386 atcaccattgcttggaagtttgattctcCcattgagacccagagcagcagttc
ZBTB16 RARA 7849296 CACAGGCAGACCCATACTgCCATTGAGACCCAGAGCAGC
ZBTB16 RARA 7849296 CACTTACTGGCTCATTCAgCCATTGAGACCCAGAGCAGC
ZBTB16 RARA 9389704 ctggctcattcagCcattgagacc

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)