TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'PLAG1'. The HGNC name for this gene is 'PLAG1'.

6 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CHCHD7 PLAG1 16736500 GTGAGCCATTGACGTGTTTGGAGCTGGAGACGGCCTGGGTGCTGGCGAAGCGGAGGCCGGAGaTTGGCCAAAATGGGAAGGATTGGATTCCACTCTCTTCCACGAAGAGTCAATGGGACT
COL1A2 PLAG1 AF221550 TGCATGTCTAAGTGCTAGACATGCTCAGCTTTGTGGATACGCGGACTTTGTTGCTGCTTGCAGTAACCTTATGCCTAGCAACATGCCAATATTGGCCAAAATGGGAAGGATTGGATTCCACTCTCTTCCACGAAGAGTCA
HAS2 PLAG1 AF221548 CTCCGGGACCACACAGACAGGCTGAGGACGACTTTATGACCAAGAGCTGAACAAGATTGGCCAAAATGGGAAGGATTGGATTCCACTCTCTTCCACGAAGAGTCAATGGGACTGGCTAAGATCAAAGTCTGAGGCTTTTT
HAS2 PLAG1 AF221549 CTGAGGACGACTTTATGACCAAGAGCTGAACAAGGTTGCCTCTTGGTGCTGCCTTGGCCGTATTTGGCAC
LIFR PLAG1 9525740 TCTGCGACTCATTCATCGCCCTCCAgATTGGCCAAAATGGGAAGGATTGGA
TCEA1 PLAG1 10029085 ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAACGCgATTGGCCAAAATGGGAAGGATTGGATTCCACTCTCTTCCACGAAGAGTCAA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)