TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'PICALM'. The HGNC name for this gene is 'PICALM'.

11 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
KMT2A PICALM AF477007 ATTGAAATGAAATACTcTAATCTGGAACTCCTGACCTC
PICALM MLLT10 10554802 GCTTGGAATGCTGCAACAATgAAATATAAAGAGAAGGACAAA
PICALM MLLT10 10554802 GCTTGGAATGCTGCAACAATgAGATGTGAACTTTGTCCCCAT
PICALM MLLT10 10554802 GGCATGATAGGATATGGAATtAGATGTGAACTTTGTCCCCAT
PICALM MLLT10 10554802 GGCCCTGTATCAGGAGCACAgACTTATACAAGCACTAGCAAC
PICALM MLLT10 10554802 GGCCCTGTATCAGGAGCACAgAGATGTGAACTTTGTCCCCAT
PICALM MLLT10 12555219 GCAGCCAGAGTGATACAGTTTATGTAA
PICALM MLLT10 12555219 GCAGCCAGAGTgCCTCCACAAATGGGA
PICALM MLLT10 12555219 GCAGCCAGAGTgGCACCCCCTGTAATG
PICALM MLLT10 AF060929 CGAGAACCCGCTGGTTTATTGCGACGGGCACGGCTGCAGCGTCGCGGTGCATCAAGCTTGCTATGGCATTGTTCAAGTACCCACTGGACCGTGGTTTTGCAGGAAATGTGAATCTCAGGAGAGAGCAGCCAGAGTGTTATTGCTTACTGTGAGCTAAGACAGTTTTGCCTAACCTCGAAGTCATGAAGCCTCCACAAATGGGAAGTGTTCCTGTAATGACGCAACCAACCTTAATATACAGCCAGCCTGTCATGAGACCTCCAAACCCCTTTGGCCCTGTATCAGGAGCACAGATACAGTTTATGTAACTTGATGGAAGAAAATGGAATTACTCCAAAAAGACAAGTGCTCAAGCAGCAAAATCCTT
PICALM MLLT10 AF060933 GGATCTAACTGCGAACCAAAGGTTGCACCAACAACCGCTTGGAATGCTGCAACAATGGTTGGGCCCATGTGGTTTGTGCCCTGTATATTCCAGA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)