TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'PDGFRB'. The HGNC name for this gene is 'PDGFRB'.

28 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CAPRIN1 PDGFRB 17296564 CAGCACCTGCAGTTGAAGACCAGGTACCTGAAGCTGccttgccctttaaggtggtggtgatctcagccatcc
CCDC6 PDGFRB 10910073 AGTTCAAGCAGGCCTATATCACCTGccttgccctttaaggtggtg
CCDC6 PDGFRB 11389034 AGCAGGCCTATATCACCTGccttgccctttaaggtg
CCDC6 PDGFRB 17211520 agcaggcctatatcacctgCCTTGCCCTTTAAG
CCDC88C PDGFRB 15496975 AACGCAGACTTGTCAGACGCcTTGCCCTTTAAGGTGGTGGTG
CCDC88C PDGFRB 15496975 AACGCAGACTTGTCAGACGccttgccctttaaggtggtggtg
CEP85L PDGFRB 21938754 gcattgcttgaaaAgccacgttac
ERC1 PDGFRB 17690697 CACTTAGAGGAAGTTCTGGAGATGAAccttgccctttaaggtggtggtg
ERC1 PDGFRB 17690697 CACTTAGAGGAAGTTCTGGAGATGAAgtgtccacgtgagctgccgccc
ETV6 PDGFRB 17122866 ggcttttgttcagGtgtccacgtgagc
ETV6 PDGFRB 8168137 GAGGTCATACTGCATCAGAACCATGAAGAAgCCTTGCCCTTTAAGGTGGTGGTGATCTCA
GIT2 PDGFRB 17296564 GGAGACAGCAGGGCAGTTCTCTCTCGGGTTCAAAAGccttgccctttaaggtggtggtgatctcagccatcc
GOLGA4 PDGFRB 20085582 aaagaaaagtccgaaagagctgCcttgccctttaaggtggtg
HIP1 PDGFRB 9616134 TGTTGCTGAGGGCTGGGAAGAAgCCTTGCCCTTTAAGGTGGTG
NDE1 PDGFRB 17301821 AAGGATGAAGCCAGAGccttgccctttaaggt
NIN PDGFRB AY764157 ATAAAAGTATTTGATATTTTTAAAGAATAAATACAGAAATAATGCCTATTTAGGTAGAAAAAAAACTTTTGGTGCCATCTAACACCTTAAGATGTCAACATTCTAAGCTTACATCTTTCTGACTTGCCCAGCACTGGGGAGGGCCATCCGCATCCAGCCGAGTACCCTACCTGGTGTCACTT
PDE4DIP PDGFRB 12907457 AGATCCACATTAGCcTTGCCCTTTAAG
PRKG2 PDGFRB 17296564 ACCAAGATCATTGACTGCTTGGAAGTGcctttgaatgtgtttgcGAGCTCTGACGGCCATGAGTACATCTAC
PRKG2 PDGFRB 17296564 TTTTAGTTATTTTTTGCCTTCTGCTAGCCTTTGAATGTGTTTGCgagctctgacggccatgagtacatctac
PRKG2 PDGFRB 18166785 caaggagaaccaggaaaggatatctttgtgctggcagAGGGtgagtctgtgagctctgacggccatgagtacatctac
RABEP1 PDGFRB 11588050 GAAAACTGCAAGGAGGAAATAGcCTTGCCCTTTAAGGTGGTGGTGATC
SPECC1 PDGFRB 15087372 AGTGAGCTAGAAaCCTTGCCCTTTAAG
TP53BP1 PDGFRB 15492236 CGCAAGTCTGCCACAGTAAAACCTgCCTTGCCCTTTAAGGTGGTGGTGGTGATCTCA
TP53BP1 PDGFRB 15492236 TTGCACCATTGCACTCCAGCCTGgGGCTCCAGGGCTAATGGGAGGTCCAGGCAAT
TPM3 PDGFRB 16838028 TTGATGACCTGGAAGccttgccctttaagg
TRIP11 PDGFRB 8168137 AGAACAAATTGAAGAACTTAAAAGACAAaCCTTGCCCTTTAAGGTGGTGGTGATCTCA
TRIP11 PDGFRB 9373237 AGAACAAATTGAAGAACTTAAAAGACAAAccttgccctttaaggtggtggtgatctca
WDR48 PDGFRB 20085582 aagtctacagtaaataaatggAagccacgttacgagatccga

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)