TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'PDGFRA'. The HGNC name for this gene is 'PDGFRA'.

23 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BCR PDGFRA 12023981 CAGCAGAAGAAGTgcctgggctctcCAATCAGCCCG
BCR PDGFRA 12023981 CTGGTCCTCCATgtaagtcacagcgcccctctggacCAGCTGCCTTAT
BCR PDGFRA AY303970 TTGTCTTTAGGTACCCCAGAAAGGTTTAGACCTTAAAAGCAATGACACACCCAAAAAGGCCCGGGATGGACATGAATATATTTATGTGGACCCGATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGAGATGGACTAGTG
CDK5RAP2 PDGFRA 16845659 AAGGACGTGTTGCTTCAGgcctggagccctcccttctcaaagagaaccctgcgggcaaCTTATGACTCAAGATG
ETV6 PDGFRA 17555450 CACTGTATTCTTGCTTCCACAAcagttacctgtcctggtcatttat
ETV6 PDGFRA 17555450 TGGGGAAACCATAAGaaaccgaggtatgaa
FIP1L1 PDGFRA 12660384 AAAATTTAAACGAGGGTCATTGAATCAATCAGCCCGGATGGACATGAATATATTTATGTGGACCCGATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGA
FIP1L1 PDGFRA 12660384 AATATTTCAGTCTGGTCTTCTTCTGTATACCGGTTTCCTTTTAGGAGACTGCTAcAGATGGGAGTTTCCAAGA
FIP1L1 PDGFRA 12660384 AGCAAATGCTTTGTTTTAATCTTAATGCaCAGCCCGGATGGACATGAATATATTTATGTGGACC
FIP1L1 PDGFRA 12660384 ATAAGTTATTTAATTTGTTATAATGATTTGTTAATTTATGAtCATGAATATATTTATGTGGACCCGATGCAGCTGCCTTATGAC
FIP1L1 PDGFRA 12660384 ATATGGGAGGGCCGAATCACCTGATCTAAgCCCGGATGGACATGAATATATTTATGTGGA
FIP1L1 PDGFRA 12660384 CCTCTGATTCCACCACCGGCACAGTGTCCtCCGATGCAGCTGCCTTATGACTCAAGATGG
FIP1L1 PDGFRA 12660384 CCTCTGATTCCACCACCGGGAGACTGCTAcAGATGGGAGTTTCCAAGAGATGGACTAGTG
FIP1L1 PDGFRA 12660384 CGACGGGCAAATGAGAACAGCAACATACAgCTGCCTTATGACTCAAGATGGGAGTTTCCA
FIP1L1 PDGFRA 12660384 CTTGTTAAATGATCTTTATGAAGTACTTTTTTCTTGTgTGGACATGAATATATTTATGTGGACCCGATGCAG
FIP1L1 PDGFRA 12660384 TGCCTGGCTTATTTCACTTAGCACAGTGTCCtCCGATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGA
FIP1L1 PDGFRA 12660384 TTTGTTCAAGACTGGGCTTCCACCGAGCAgAGATGGACATGAATATATTTATGTGGACCC
FIP1L1 PDGFRA 12660384 TTTTTAACATTAGACTTCTAATGTTTTTAAAAGTAAAGTCcATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGA
FIP1L1 PDGFRA AY229892 ACTATCAGCCGAGTAGAAGGCAGGCGACGGGCAAATGAGAACAGCAACATACAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGAGATGGACTAGTGCTTGGTCGGGTCTTGGGGTCTGGA
KIF5B PDGFRA 16498388 CCTTTCTTGAAAATgaaattcgctggagg
STRN PDGFRA 17555450 AAGAATCCATGTTCTatatttatgtggaccc
STRN PDGFRA 17555450 CATTGATACTTCAACActgccttatgactcaa
STRN PDGFRA 17555450 CATTGATACTTCAACAtttccaagagatggac

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)