TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'PDGFB'. The HGNC name for this gene is 'PDGFB'.

24 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
COL1A1 PDGFB 11329146 CGGGAATGGGGTCCCcAGCAGCACCTTTAGG
COL1A1 PDGFB 11329146 CGGGAATGGGGTCCCcCTTGTCACCAGGGG
COL1A1 PDGFB 11329146 CGGGAATGGGGTCCCcTCTGTCACCCTTAGGC
COL1A1 PDGFB 12034531 AGGCAAACCTGGTGAACAgGGGGACCCCATTCCCGAGG
COL1A1 PDGFB 9771975 CCAGGTGAAGCAGGCAAACCTGGTGAACAgGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGA
COL1A1 PDGFB 9771975 CCTGGTCCTGATGGCAAAACTGGCCCCCCtGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGA
COL1A1 PDGFB 9771975 GTCGGTCTTCCAGGGCCTAAGGGTGACAGaGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGA
COL1A1 PDGFB X98705 AGGACCGCCTCTCCCATGAGTTGGCCCCAGCTCCCGTGAAGATTGCAGTGGGGAGGTTTCCCTGGGAGTTGGGAGACCTCTTGCAGGAGCAGAGGCTGAGCGGGAGGGTCCCAAGAGCAATAAAGAAGGGGAATGCTAGGTGGGAAACACTGGTTCTAATGGCTTCTGTGGTTTGC
COL1A1 PDGFB X98705 CCGCCTCTCCCATGAGTTGGCCCCAGCTCCCGTGAAGATTGCAGTGGGGAGGTTTCCCTGGGAGTTGGGAGACCTCTTGCAGGAGCAGAGGCTGAGCGGGAGGGTCCCAAGAGCAATAAAGAAGGGGAATGCTAGGTGGGAAACACTGGTTCTAATGGCTTCTGTGGTTTGCCCCGAGAGGGCTTCTTCAAAGGGGTTGGTTGGCTTTGGCATTCGATCTAAATAAGGCCTGCGACTCTCAGGCAGG
COL1A1 PDGFB X98709 CTGGCCCCATGGGTCCCTCTGGTCCTCGTGGTCTCCCTGGCCCCCCTGGTGCACCTGGTCCCCAAGGCTTCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCAGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCTTTGA
COL1A1 PDGFB X98709 TCCCCAAGGCTTCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCAGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCTTTGA
COL1A1 PDGFB X98710 CGTCCTGGTGAGCGTGGGCCTCCTGGGCCTCAGGGTGCTCGAGGATTGCCCGGAACAGCTGGCCTCCCTGGAATGAAGGGACACAGAGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCTTTGA
COL1A1 PDGFB X98710 GGCCTCAGGGTGCTCGAGGATTGCCCGGAACAGCTGGCCTCCCTGGAATGAAGGGACACAGAGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCTTTGA
COL1A1 PDGFB Y15911 GAGGGCAGGAGAGATGCTCAGAGATCTCTTGGTAAGATTGGAGAAGGTTGACGGGGACCCACGCCTCCTGGCAGAATTAGAATTGAATCGAATGTTCTTCAAGCCCCTCGATTCACAGATGAGAGCCAGGACCATAGGGGCAGTGACCAGCCGAGGTCACACGGCAGTTGGTCCAAAGGCGTGGGATTCCGCTCTCTGGCCTGCCAGTTCTGGGTTTGACAGAACTCTCAGGGGA
COL1A1 PDGFB Y15913 GGACCCCCTGGCCCCATTGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCTTTGA
COL1A1 PDGFB Y15914 AGGTCCCTCTGGAGCCTCTGGTCCTGCTGGTCCCCGAGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCTTTGA
COL1A1 PDGFB Y15915 CAGGCGAACAGGGCGACAGAGGCATAAAGGGTCACCGTGGCTTCTCTGGCCTCCAGGGTCCCCCTGGCCCTCCTGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCTTTGA
COL1A1 PDGFB Y15919 CCCCTGGTGCTACTGGTTTCCCTGGTGCTACTGACCGAGTCGGTCCTCCTGGCCCCTCTGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCTTTGA
COL1A1 PDGFB Y16341 TCTGTGCCCACGAGGCTGGTGGGCTGGGACCCAGGACGGGTCCAGGCTTGATGCTTGTTTAATTTTTTCTAAGCTTCAGTGTTCTCATCTGGAGGATGGGGATACAAATACTGCCAGCCTCTTA
COL1A1 PDGFB Y16342 GCTCCCCAATCCGTCCTCCCCTGGCTCAGCGGCTGGGAGGAGCCTGGTCGTGCTCGGACTAATCTTTCAGCAGACGGCAGGCAGCCGTGAGGCAGGGCTGGGTGGAGGGCCTGCCGAGGCCTCT
COL1A1 PDGFB Y16343 GAAGAGGTCTCTGCCTATGGACACCCTCGGGCTAGATTTCCAGAATAATGAAGGGGCATGGGTTGCCACACTGCCCTTGTCTCAACAGGTGGGCAGTCTGGAGCCTGGGAACGACCCAGCTCTGCCACTTGCTAATTGTCTGGACCTGTTGCTGCTTGTTTAATTTTTTCTAAGCTTCAGTGTTC
COL1A1 PDGFB Y16344 CCGGCCCCATTGGTCCTCCTGGCCCTGCTGGTGCCCCTGGTGACAAGGTGAGGTGGCCGCCTCCCGTGGGTGGCCAGAGTTGGTCATGGATGAACCCCTGGAGGTGTTGCTAGACCTCATGATAAGCTGGAGGAAACAGAGCTTTCGGGGAGAGCCCCCTGAGGCTGGCCACAGGGCTGAGACG
COL1A1 PDGFB Y16345 CGCCGGTCAAGATGGTCGCCCCGGACCCCCAGGCCCACCTGGTGCCCGTGGTCAGGCTGGTGTGATGGGATTCCCTGGACCTAAAGGTGCTGCTGTGAGTATTAAGTGAGGATCCATGAAGCCAGGACCATAGGGGCAGTGACCAGCCGAGGTCACACGGCAGTTGGTCCAAAGGCGTG
COL1A1 PDGFB Y16346 TGGCCGAGTCGGTCCTCCTGGCCCCTCTGGAAATGCTGGACCCCCTGGCCCTCCTGGTCCTGCTGGCAAAGAAGGCGGCAAAGGTCCCCGTGGTGAGACTGGCCCTGCTGGACGTCCTGGTGAAGTTGGTCCCCCTGGTCCCCCTGGCCCTGCTGGCGAGAAAGGATCCCCTGGTGCTGATGGTCCTGCTGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACC

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)