TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'PBX1'. The HGNC name for this gene is 'PBX1'.

31 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
EWSR1 PBX1 18383210 ggaggactcggtggaatgggGcggaagagacggaatt
TCF3 PBX1 12415113 AGGCCAGGGCATCTCACCGCcgcatctgatccgtgcccATATGTGATGACGCTCAAACA
TCF3 PBX1 12415113 AGGCCAGGGCATCTCACCGCtgacttggtcgctcgAAGAGGATACCCTGAGCTCAC
TCF3 PBX1 12415113 ATCACTCCTAGGCCAGGGCAaactgaCCTACAAATAGGTGAAAGTT
TCF3 PBX1 12415113 ATCTCTTGATGTGCTGAAGCaggccGCTGTTGGCTAACTGGTCGTCTCAGCTGAA
TCF3 PBX1 12415113 CAGGGCATCTCACCGCAGCcccagggtaagggccttccctatgaaagagccagccacaaaAGACACTAGTAGTATTTTA
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCaaggaggggtaggtccGCTGGGCGCTGCTGCCAGAT
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCacgcccgaaatatCATGGCTTAGGAGAACCGTG
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCagCAAGTGAGGGCGGAGTTTGC
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCtTGCTTTATGCTTTAAGCTTT
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCtggagtccgCAGACATTTAGTGTCAGGGG
TCF3 PBX1 12415113 CCCAGTGTCCCCTGGGGGCAgggctTTTCTTAAGAGCAATATAATA
TCF3 PBX1 12415113 CCCTTTCATCTTGTGGTCCTtCTTGAATAGCTGGGATTACA
TCF3 PBX1 12415113 CTAAGCCAGGGCATCTCACCcgctcctATTCTAACTATTTCTCATTT
TCF3 PBX1 12415113 CTAAGCCAGGGCATCTCACCcgctcctATTTCTCATTTCTCCTTCTT
TCF3 PBX1 12415113 CTAGGCCAGGGCATCTCACCttCCCATCCAGAAAGGCAGGGGC
TCF3 PBX1 12415113 GCCAGGGCATCTCACCGCAGaaccgaccgcgactaagcgaaacctccgaaatttcggatTTGCACAGCTTTCCCAGGGC
TCF3 PBX1 12415113 GCCAGGGCATCTCACCGCAGagacgggaccatcccGTTTCTCTCTCTCAGCTCAGC
TCF3 PBX1 12415113 GCCAGGGCATCTCACCGCAGtggggtcagcgGAGCTTGCCTGGAAGCATAGG
TCF3 PBX1 12415113 GCCTGGGGGCAGAGCCGCTGtcgcccAGATAAAGAACAAGACAGAA
TCF3 PBX1 12415113 GGATTTCTGGCCCGAGCTGTaggctcCCACCCTACCCACACATTC
TCF3 PBX1 12415113 GGGCATTCTATCACCCAATAaagaagggcGCGGCTCTGCCCCCAGGGGAC
TCF3 PBX1 12415113 TAGGCCAGGGCATCTCACCGggttcggtctcggggCTAACCATGATGGTGGAAAGA
TCF3 PBX1 12415113 TCCCCTGGGGGCAGAGCCGCctcaccgcacctttaAGCATGCTGTTGGGTAGAAG
TCF3 PBX1 12415113 TCCTAGGCCAGGGCATCTCAtccaGGCTCTGGTACAACTTGTAA
TCF3 PBX1 12415113 TGGAGCAGAGTAAGGAGAGGttaatgggtaacttttcggTTTGTGAAAGCATTGTAGAA
TCF3 PBX1 12415113 TGTTTTGTTTTGAGACAGGGccccctactgaaaccccCAAAGGGAAGAGGGTCCAGA
TCF3 PBX1 12415113 TTCATCTTGTGGTCCTTAATggccATTTTCTCATTTGACAAGTT
TCF3 PBX1 12415113 TTGCCAGGGCATCTCACCGCcaccaaatcaaaaTACCCTCTTCTGGTTATAATT
TCF3 PBX1 17593026 ccgggcccggaccagGcggaagagacggaattt
TCF3 PBX1 M31522 CGCGGCCCTCCCCAGCCAGCCAGGCACCCTCCCTGACCTGTCTCGGCCTCCCGACTCCTACAGTGTTTTGAGTATCCGAGGAGCCCAGGAGGAGGAACCCACAGACCCCCAGCTGATGCGGCTGGACAACATGCTGTTAG

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)