TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'PAX3'. The HGNC name for this gene is 'PAX3'.

5 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
FOXO1 PAX3 8275086 AGCACCAGGCATGGATTTTCCAGCTATACAGACAGCTTTGTGCCTCCGTCGGGGCCCTCCAACCCCATGAACCCCACCATTGGCAATGGCCTCTCACCTCAGAATTCAATTCGTCATAATCTGTCCCTACACAGCAAGTTCATTCGTGTGCAGAATGAAGGAACTGGAAAAAGTTCTTGGTGGATGCTCAATCCAGAGGGTGGCAAGAGC
PAX3 NCOA1 15313887 tctattccacaagGattacctga
PAX3 NCOA1 19953635 gcctctcacctcagTttacagctgacc
PAX3 NCOA1 19953635 tctattccacaagGattacctgag
PAX3 NCOA2 19953635 cacctcagCctggcagtgagctggac

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)