TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'NUP98'. The HGNC name for this gene is 'NUP98'.

49 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
ANKRD28 NUP98 17988990 ATTTTGAAGAGGACACCTATTCATGCAGCAGctttgacagatccaaatgcttctgctgcc
NUP98 ADD3 12810632 GGCTTTGGAGCCCCCCAGGCCCCAGTAGAAAACCATGAGCTGTTTTCCAAGAGCTTCATC
NUP98 ADD3 12810632 GGCTTTGGAGCCCCCCAGGCCCCAGTAGATGCTGAGCAGGAATTACTCTCAGATGACGCT
NUP98 CCDC28A 16028218 ctcttccggaatccgatgtcagaccctaagaagaaggaagagGtcttaagaagctggccgtggtgcaat
NUP98 DDX10 AB001342 AAATATACTCGTGTGCACACCAGGTCGGCTTCTTCAACACATGGATGAAACAGTATCTTTTCATGCTACCGACCTCCAAATGTTAGCTTTGACAGATCCAAATGCTTCTGCTGCCCAGCAGGCTGTTCTCCAGCAGCACATCAATAGTCTAACATACTCACCTTTT
NUP98 DDX10 AB001343 GGACCTTGCACGCTTGAGTTTGAAAAACCCTGAGTATGTCTGGGTTCATGAAAAAGCAAAATATAGGAAGAGCATTAAGAAGTTGGTTTTGAAGAACCTTAATAATAGCAATCTCTTTTCTCC
NUP98 HHEX 18388181 AAGAAGAAGGAAGAGaggcctctgcataaaaggaaagg
NUP98 HHEX 18388181 CTTCAACAGGTATCTtcttgcagaggcctctgcataaa
NUP98 HMGB3 19956199 TTGGTGCAGGATTTGGAACAGtCAGGATGGCTAAAGGTGAC
NUP98 HOXA11 11830496 TTGGGCTTTGGAGCCCCCCAGGCCCCAGTAgGTGGCCAACGCACC
NUP98 HOXA11 19338047 ttggagccccccaggccccagtagGtggccaacgcaccc
NUP98 HOXA13 12112533 GGAGCCCCCCAGGCCCCAGTAGaCGTGGTCTCCCATCCCTCGGATGCC
NUP98 HOXA9 10583265 CTGGGACTCTTGGAACTGGGCTTGGTGCAGGATTTGGAACAgTTGATAGAGAAAAAC
NUP98 HOXA9 U41814 ACTACGACAGCCACTTTGGGCTTTGGAGCCCCCCAGGCCCCAGTAgTTGATAGAGAAAAACAACCCAGCGAAGGCGCCTTCTCTGAAAACA
NUP98 HOXC11 12183408 AGGGGGAGCCCGAGGCACCcTTAGCTCATGTATCCACCTC
NUP98 HOXC11 12183408 CAGGCCCCAGTAGATGAGAAtCCGGCCTCGGGACTG
NUP98 HOXC11 12183408 CTGTTATGGTAGATGAGAAtCCGGCCTCGGGACTGGCGTC
NUP98 HOXC11 12970787 GGCTTTGGAGCCCCCCAGGCCCCAGTAgACGCCCCCCGCACCCGCAAGAAGCGCTGCCC
NUP98 HOXC13 12619167 CATATGCACCCAGCAgACGTGGTTCCCCTG
NUP98 HOXC13 19665070 ataattcttaccatatgcacccagcagAcgtggttcccctgcagcccga
NUP98 HOXD11 11782354 ACTGGGCTTGGTGCAGGATTTGGAACAgTTGCCCCCCAGCGGTCCCGGAAAAAGCGC
NUP98 HOXD13 AB038155 GATTGGAGGGCCTCTTGGTACAGGAGCCTTTGGGGCCCCTGGATTTAATACTACGACAGCCACTTTGGGCTTTGGAGCCCCCCAGGCCCCAGTAGGGGATGTGGCTCTAAATCAGCCGGACATGTGCGTCTACCGAAGAGGGAGGAAGAAGAGAGTGCCTTACACCAAACTGCAGCTTAAAGAACTGGAGAACGAGTATGCCATTAACAA
NUP98 IQCG 18084320 CCTAAGAAGAAGGAAGAGaaacttgaggagaggctg
NUP98 KDM5A 16419055 TCAGACCCTAAGAAGAAGGAAGAggATGACAGCATGGAAGAGAAACCA
NUP98 KMT2A 20558618 atgtcagaccctaagaagaaggaagagGatgagcaattcttaggttttggctca
NUP98 LNP1 18603550 AAGAAGAAGGAAGAGggacaggccttcagtatttggcatcacctttacatg
NUP98 NSD1 11493482 ACCACAGGCTGAGCTCCCTGAACCAGctttgacagatccaaat
NUP98 NSD1 11493482 ACGACAGCCACTTTGGGCTTTGGAGCCCCCCAGGCCCCAGTAgCTGTGCGGTCAGAGAAGAAACGCCTTAGGAAGCCAAGCAAGTGGCTT
NUP98 NSD1 11895789 ACCACAGGCTGAGCTCCCTGAACCAGctttgacagatccaaat
NUP98 NSD1 11895789 AGCCCCCCAGGCCCCAGTAGctgtgcggtcagagaagaaa
NUP98 NSD1 11895789 AGCCCCCCAGGCCCCAGTAgCTTTGACAGATCCAAATGCT
NUP98 NSD1 15382262 GCCCCCCAGGCCCCAGTAgCTGTGCGGTCAGAGAAGAAACGCCTT
NUP98 NSD1 15382262 GGTGCAGGATTTGGAACAgCTGTGCGGTCAGAGAAGAAACGCCTT
NUP98 NSD1 18068532 CCCCAGGCCCCAGTAGcTGTGCGGTCAGAGAAGAAACGC
NUP98 PRRX1 10397741 TTGGGCTTTGGAGCCCCCCAGGCCCCAgTAGATGACCAGCTGAACTCAGAAGAAAAAAAGAAGAGAAAGCAGCGAAGG
NUP98 PRRX1 10397741 TTGGGCTTTGGAGCCCCCCAGGCCCCAgTAGCCTACCACACCACCATCGCAGACCCCTAACTCCTGGAAAACCCTCCT
NUP98 PRRX1 15390187 CCCCCCAGGCCCCAGTAgATGACCAGCTGAACTCAGAAGAAA
NUP98 PRRX2 15496970 GGAACTGGGCTTGGTGCAGGATTTGGAACAgGTGAGTGTCCCAGCCCGGGGCGCGGTAGC
NUP98 PSIP1 11103774 ACTGGATTTGGTGCTGTTGGTTCgGCAGAAAAACAAGTAGAAACTGAG
NUP98 PSIP1 15725483 ggtgctgttggttcgGcagcaactaaacaa
NUP98 RAP1GDS1 AF133332 ACGACAGCCACTTTGGGCTTTGGAGCCCCCCAGGCCCCAGTAGCAGATAATCTCAGTGATACCTTGAAGAAGCTGAAGATAACAGCTGTT
NUP98 RAP1GDS1 AF133334 ACCAGTGCACCTTCATTTGGTACAACCAGTGGCGGGCTCTTTGCAGATAATCTCAGTGATACCTTGAAGAAGCTGAAGATAACAGCTGTT
NUP98 SETBP1 17233820 gctttggagccccccaggccccagtagTcggctcctccctgaagaaga
NUP98 TOP1 10556215 ATGTCAGACCCTAAGAAGAAGGAAGAgGATGGTAAATTGAAAAAACCCAAGAAT
NUP98 TOP1 11979559 CAAGCATTTTGGATGAGGGATACTCAACATGTACAAAGTTGGGTGTtCTTGGCCGAAGTTCAAATTAATAAGCACTAATTCAAGGAATTGAGAGTGAAAT
NUP98 TOP1 12645654 ATGTCAGACCCTAAGAAGAAGGAAGAgGATGGTAAATTGAAAAAACCCAAGAAT
NUP98 TOP1 15036893 ATGTCAGACCCTAAGAAGAAgGAAGAGGATGGTAAATTGAAAAAACCCAAGAAT
NUP98 TOP1 15390187 CCCTAAGAAGAAGGAAGAGgATGGTAAATTGAAAAAACCCAAGAA
NUP98 WHSC1L1 11986249 ACTGGGCTTGGTGCAGGATTTGGAACAgGTGCCCGAGAATATCATGTCCAGTTT

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)