TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'NR4A3'. The HGNC name for this gene is 'NR4A3'.

16 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
EWSR1 NR4A3 12378528 AACCCATGATCCACATCTACCTGGACAAGGAAACAGGAAaGATATGTTTTATTAGTTAGAATTGGGATATATATATGTGT
EWSR1 NR4A3 12378528 AGAGTTTGAAGCTCCAGTGAGCTGAGATTGCACCACTGCaGATTTCATCCCAACAACTGGACAGCAAGATAAGTAACTGG
EWSR1 NR4A3 12378528 ATCTTAACCAGTGTACATTTGCATATAGATAAAACCTTtTCTCTTGTCCCCTATGCAGATATGCCCTGCGTCCAAGCCCAATA
EWSR1 NR4A3 12378528 CCAAGGAGTTCACTAGCAGCCTGGGCAACCTAGTGAGACaGACTTCAAGTTTCCCAAATCTAGTGGAGGACAGGGCAAGG
EWSR1 NR4A3 12378528 CCACTGCACTCCAGCCCGGGCAACAGAGTGAGACTCCCaTTCACGGTTTCCTCCACACACTTCACCACCGGGAGGGAAC
EWSR1 NR4A3 12378528 GATGCTTTATCGTGATGTAAAGAAGATGGTGCCTTGGTTaAAGGGGCTTTGACAGAGGTAGTTATTTCTTCCTAATTTACAAC
EWSR1 NR4A3 12378528 GCTTCCCACCAGCTTATTTTCCTCCTTATGGTAGACAGTgAAATCATCCACTACATCCAATAATTCTCAGCGCCTTCTCACTC
EWSR1 NR4A3 12378528 GGCCATGTCCAGTGGCTTGCACCTGTAATCCCAGCACTTtAGGTTATAGCTGAGGAGCCCACTCCAATTAGTTTATAGGA
EWSR1 NR4A3 12378528 GTGAACAGGGAGTACAGGGGAGTAATTGATGTTCtTGTTGAATGACAGAAAAGAGTAATGGAGAAATCCTAGCGGTGCTG
EWSR1 NR4A3 12378528 TCTAGCTAGAAACCTCAGAAAGACACAAATAAGAGCAGTAAAAaGGGAGCAAACTTAAAGTCTCCCTTGCTCGGAAAGAAGC
EWSR1 NR4A3 12378528 TTAAGTGTATTTAAGTATGGCCTTTTTCTGGCCAGGCACaCAAAGAGTAAATTTGAGTTTGGCAAAAGAACAGATTGCAC
TAF15 NR4A3 12378528 CCCAGCATTTTGGGAGGCCGAGGTGGGCAGATCACGAGGTCAGGAgGCCCTCATCACCTTTTTTCAAGTCAAGATTTCAT
TAF15 NR4A3 12378528 CTCTATTATTATTTTTCCCCCTCTCAGTTTTATTAGTTAGAATTGGGATATATATATGT
TAF15 NR4A3 12378528 TTTCTTGCCTAACTCAGGTTTACAAATCAATGTGTATGCCCAACATGTGCCATTTTCTATAAGGATATGTGTGGCCTAAAGA
TCF12 NR4A3 AF289510 GGACTTCAGTGCGATGTTTTCCCCACCTGTTAATAGTGGGAAAACTAGACCAACTACACTGGGAAGCAGTCAATTCAGTGGATCAGGTATTGATGAAAGAGGAGGTACAACATCTTGGGGAACAAGTGGTCAACCAAGTCCTTCCTATGATTCATCTAGAGGTTTTACAGACAGCCCTCATTACAGTGATCACTTGAATGACAGTCGATTAGGAGCCCATGAAGGCTTGTCCCCAACACCTTTCATGAACTCAAATCTGATGGATATGCCCTGCGTCCAAGCCCAATATAGCCCTTCCCCTCCAGGTTCCAGTTATGCGGCGCAGACATACAGCTCGGAATACACCACGGAGATCATGAACCCCGACTACACCAAGCTGACCATGGACCTTGGCAGCACTGAGATCACGGCTACAGCCACC
TFG NR4A3 AY532911 CAGCAGCCACCATATACAGGAGCTCAGACTCAAGCAGGTCAGATTGAAGGTCAGATGTACCAACAGTACCAGCAACAGGCCGGCTATGGTGCACAGCAGCCGCAGGCTCCACCTCAGCAGCCTCAACAGTATGGTATTCAGTATTCAGATATGCCCTGCGTCCAAGCCCAATAT

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)