TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'NPM1'. The HGNC name for this gene is 'NPM1'.

6 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
NPM1 ALK 20207848 cacttagtagTgtaccgccgg
NPM1 ALK AF032882 GTTAGGGAAACAGGGCAGGAGTTACCATCCCTGCCTACAGAGAGGGAAACTGCAGTCCAAAGAGGTCCTGTGACCTGGTCCTCATGGCTCAGCTTGTAAGTAACAAGAGGCGGAATTAGAGCACAGATCCCCAGACACCAATTCAGATCCTAGGAAGTCTCAGTTTTTAGAGTATTTACTATCAGTGTTCTTTTTTTTTCTGACTTCTTGCTGCTTGAGTTTTATAATGTCTAATAAATTGTATTTTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGA
NPM1 ALK S82725 TCTCAGTTTTTAGAGTCATTTACTATCAGTGTTCTTTTTTTTCTGACCCCTGGGCCAGCTGCACCCTCAAATCCACTGCTGTGATTGCACTGAAGCTGCCCTACCCAATGGCTGAGCACAGCAGAAATACTAAGGCAGGC
NPM1 MLF1 20471513 tgatgacgatgatgatgaagaggatgatgatgaagaTgagtccattcttgcacaccgagaaaatatgcgacag
NPM1 RARA 9989813 GGGCCAGTGCATATTAGTGGACAGCACCTTAGTAGCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTA
NPM1 RARA 9989813 GGGCCAGTGCATATTAGTGGACAGCACCTTAGTAgCCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)