TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'NCOA4'. The HGNC name for this gene is 'NCOA4'.

15 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
NCOA4 RET 10597232 ATCATGGCAGGCTTtATTCTGCTTACGCTT
NCOA4 RET 10597232 CAGTCCCAAGTGGGCtGAAGCTGGGAGGCA
NCOA4 RET 10597232 CATCGGGCAGGGGAgTTTTTTAGTAGATACGG
NCOA4 RET 10597232 GAAAGTTTAGAAAAtAGAGACAGGCAGGTTC
NCOA4 RET 10597232 GCCTTCCCAGATGTGgTTTGATGACTTGCCT
NCOA4 RET 10597232 GCTGGGCAGACGAGGgAGGCAGAGCTTGCA
NCOA4 RET 10597232 GGCTTTGGCCTCCCtAGATTCTAATTCTGC
NCOA4 RET 10597232 GGTGTGAGCCAAGGaAGCTGGCGTGGTGG
NCOA4 RET 10597232 GTGGTGGCCTGCCcTCCTGCCTCAGCCTCC
NCOA4 RET 10597232 TCGAGACCATCCTGgGGGGGCCAGGGTGGG
NCOA4 RET 10597232 TGTCGACACTGACCTTgAATACAAAAAAAAAAA
NCOA4 RET 10597232 TTCCTACTAGCACTGtTGATCTGCCTGCCTC
NCOA4 RET S74821 AAATTTCAAAACACTGGGCAAGACAGTAAATATGCAGACAGGGCCCTGCCCCTTCAGTGTTCCTACTAGCACTGTCCAGG
NCOA4 RET S74825 TCCTGGCCAGGCAGGCCTCTGCCCTCTCCTGGTGGTGGCCGGGCCGGGCGTGGTGGCTCACGCCTGTAATCCCA
NCOA4 RET S83049 ACCCATCTCCTCAGCTGAGATGACCTTCCGGAGGCCCGCTGTAAAGGCATATTACACCCTTTTCTATCAGATAAGAGTA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)