TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'MYH11'. The HGNC name for this gene is 'MYH11'.

7 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CBFB MYH11 18024381 GTCTCATCGGGAGGAAATGGAGccctgtccctggctcgggcc
CBFB MYH11 AF202996 ACGCGAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGGAGCTGCTTCAAGAAGAAACCCGGCAGAAGCTCAACGTGTCTA
CBFB MYH11 AF249897 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGAATGAAGTTGAGAGCGTCACAGGGATGCTTAACGAGGCCGAGGGGAAGGCCATTAAGCTGGCCAAGGACGTGGCGTCCCTCAGTTCCCAGCTCCAGGACACCCAGGAGTT
CBFB MYH11 AF249898 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGGTCCATGAGCTGGAGAAGTCCAAGCGGGCCCTGGAGACCCAGATGGAGGAGATGAAGACG
CBFB MYH11 AF251768 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGTTCAAGAGGGCCAAGGCGAACCTAGACAAGAATAAG
CBFB MYH11 AF390860 GACTCCGTCTCAAAAAAAAAAAAAAAAAAtACATCTGAGTCGTACATGGTTGTTAGCCGAGGAGAAAAACATCTCTTCCAAATACGCGGATG
CBFB MYH11 X87833 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGACTTAGCAATAGGGAGAACTAGCAGTGACTAAGGAGGCTGACATTAATGCCAATTGCCAAGGCGAACCTAGACAAGAATaAGCAGAATGAGGAGAAGAG

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)