TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'MYC'. The HGNC name for this gene is 'MYC'.

52 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
Ig MYC 17541401 CTGGGCTGAGCTGGGCTGAAATGGGCAGAATAGCCTCCCC
Ig MYC 17541401 GGGTCCTTCAGTGGTTATTACGCCAAGCCTCTGAGAAGCC
Ig MYC 17541401 GTGCAGCCTCTGGGTTCACCGTGCCCGCCCGCTGCTATGG
Ig MYC AJ586971 TGCTTACCTGGTTTTCCACTACCCGAAAAAAATCCAGCGTCTAAGCAGCTGCAAGGAGAGCCTTTCAGAGAAGCGGGTCCTGGGCTGAGCTAGGCTGAGCTGAGCTGGGNNNTGGTTGACATGGACTGAGCTGTGTTGAGCTGGGCTAGG
Ig MYC AJ586972 ATTTAGGCATTCGACTCATCTCAGCATTAAAGTGATAAAAAAATAAATTAAAAGGCAAGTGGACTTCGGTGCTTACCTGGTTTTCCACTACCCGAAAAAAATCCAGCGTCTAAGCAGCTGAGATGGGCTGGGCTGGGCTGGGCTGAGCTGGGCTGAGCTGAGCTGGACTGAGCTGGGCTGGGCTGGGCTAGGCTGGGCTGGGCTGGGCTGGGCTGGGCTGGGCTAGGCTGGGCTGGGCTGGGCTAGATTG
Ig MYC AJ586974 ACAGGCGGGCGGGACGCGCCGCAGTGTCCGTCTCCGGCTGTCAGAAATGCGGTGAGCCGAAATTTAAATGCCCTCCCGGAGACGGGGACAAGTCAGCGGCTGCGGAGCGATCTGGCTCACACAGGCGATATGCGGTCTAAATACCTCTCCCAGGCCAACCCTACACCTGCAGGCCCTCCCCTCCACTGCCAAAGACCCTCAGTTTCTCCTGCCTGTGCCCACCCCCGTGCTCCTCCTGCCCACAGCTCGA
Ig MYC AJ586977 CCCCCGGTCCAACACCTCCCTTTTGCCAGCTTTTCTTCTTTCTCTCGCCGGCTGGAGTTTGGGCTGGACTGGGCGGGACTGAGCTGGACTGGCCTGGGCTGAGCTGGGCTGGGCTGGACTGAGCTGGACTGGCCTGGGCTGGGCTGGGCGGGATGGGCTGAGGTGGCTGCTAATGTGGGAAAGAGGCCGTGGGTTGAGTG
Ig MYC AJ586978 CTGCGCCTACCCAACACCACGTCCTAACACCTCTAGAGACCCAGGTTTTAAATTGTATTATTGCATTTTAAAAAGCCCAGTGAGCTGAACTGGGCTGAACGGGCTGAGGCGAGCAGGGCCGAGCTGAGCAGAGCTAAGCCGAGGCTGGGCTGGGCTAACCTGGGCTGGGCTGAGCTGACCTGGGTTGGGCAAGGCTGGGC
Ig MYC AJ601396 CCCGAAAAAAATCCAGCGTCTAAGCAGCTGCAAGGAGAGCCTTTCAGAGAAGCGGGTCCTGGCAGCGCAGGGGAAGTGTCCCCAAATGGGCAGCCGTAACCTGGACTGGGGCTGAGCTAACCTGGGCAGA
Ig MYC AJ601397 CCAGGACGCCCGCAGCGCAGCTCTGCTCGCCCGGCTCTTCCACCCTAGCCGGCCGCCCGCTCGCTCCCTCTGCCTCTCGCTGGAATTACTACAGCGAGTTAGATAAAGCCCCGAAAACCGGCTTTTATACTCAGCGCCAGCCCCCAGGAAAGGGGCTGGAGTGGATTGGGGAAATCACTCATAGTGGAAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAA
Ig MYC AJ601398 CCAAGCCTCTGAGAAGCCCTGCCCTTCTCGAGGCAGGAGGGGAGCCAGGGACGGCCGGGGCTATGCTGGGCTGATCTGGGCTGATCTAAGCTGGGCTGGGCTGGGCTGATCGGGGCTGAGCGGGGCTGATCTGAACTATGCTGGGCTGAA
Ig MYC AJ601399 CCTCTCGCTGGAATTACTACAGCGAGTTAGATAAAGCCCCGAAAACCGGCTTTTATACTCAGCGCGATCCCTCCCTCCGTTCTTTTTCCCGCCAAGGCTCTGAGAAGCCCTGCCCTTCTGAGTTGAGCTGAGCTGGGCTAAATTGCACCA
Ig MYC AJ601400 AAAAGTGTCAATAGCGCAGGAATGGGAGAAAAGACACCCTATTTAGGCATTCGACTCATCTCAGCATTAAAGTGATAAAAAAATAAATTAAAAGGCAAGTGGACTTCGGAGTTGTACTGAGCTGGCCTGG
Ig MYC AJ601402 TCCCTCTGCCTTCTCCTCTCCCATCTTGACAAGTCACTTTACCCCGATCCAGTTCTGGATTACCCCCCACCCCAGCCCCAGTTACCATAACTACTCTGAGAAAAGTGTCAATAGCGCAGGACCATTGTCTGGGTCACTCCCATTTAACTTTCCCTAAAGCCCATTTGAAGGAGAGGTCGCACGAGCTGCTCCACAACCTCTGAATGGGGATGGCATGGGTAATGATGCTTGAGAACATACCAAGCCCCAC
Ig MYC AJ601404 GGGGCTTTCTGCCCACCGCAAAGCAACCCCCAGCCCCCCAAAACCCAGAGAGCAATTAACACAATAAAGCAGGAATGTCCGACCGGCCGGGAGTCAGCGTAAATATATTCATAAGTTGGACTGGGCTGGGCTGGGTTGGGCTGAACTGGGCTGGGCTGAGTTGGGCTGAGCTGGGCTGAGCTGAGTTGGGCTGAGCTGGGCTGAGCTGAGTTGGGCTGGGCTGAGCTGGGCTAAGCTGGACCTGGCTGGG
Ig MYC AJ628702 TTTCCAAGTCAACGATTCCAGGAGAATCGGACACATCCTCGCCTCCCTTTTCCCCTGCCTGCGCCTACCCAACACCACGTCCTAACACCTCTAGAGACCCAGGTTTTAAATTGTATTATTGCTTTTTAAAAAGCCAAATGCCAACTTCCTGGCTGGGGTGAACTAGGCTGGGCTGCGTTGAGCTGGGCTGGGCTGGGCTGGGCTGAGCTGGGCTGGGCTGAGCTGAGCTGGGCTGACCTGGGCTGGGCTG
Ig MYC AJ628704 GTCCCACCCCAGTACCGCCCCCGTCCAACACTCCTTTTGCCAGCTTTTCGACTGAGCTGTGTTGAGCTGGGCTAGGCTAAGCTAGGCTGGGCGGAGCTGAGCTGGGTTGGGCTGAGCTGAACTGGGCTGGACTGGGCTGGACTGGGCTGGGCTGGGCTGGGCTGGGCTGAGCTGAGCTGAGCTGTACTGAGCTGGCCTGGGCCAGGCTGAGCTGGGCTGGGCTGAGCTGTACTAAGCTGGCCTGGGCTGG
Ig MYC AJ628705 AGAAGCGGGTCCTGGCAGCGGCGGGGAAGTGTCCCCAAATGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGCTCGGGTGTTGTAAGTTCCAGTGCAAAGTGCCCGCCCGCTACTATGGGCAGGTGAGTAGGGGCAGGTGGGGGGCAGGAGGAGCAGGGGGCAGGCACTGGAGCTCAGGGGACCAGGGCAGAGCAGCCGCAGGTGAGCAGGGGCAGGTGGGGGGCAGGAGGAGCAGGGGGC
Ig MYC AJ628706 GATCAGGGCGGGTTGGAATCGCCGCGGGGACAGGCGGGCGGGACGCGCCGCAGTGTCCGTCTCCGGCTGTCAGAAATGCGGTGAACTGGGCTGAGCTGAGTTGGGCTGAGCTGGGCTGAGCTGAGTTGGGCTGGGCTGAGCTGGGCTAAGGTGGACCTGGCTGGGGTGACCTAGGCTGGGCTGCGCTGAGGTGGGCTGGGCTGGGCTGGGCTGAGCTGGGCTGGGCTGAGCTGAGCTGGGCTGACCTGGG
Ig MYC AJ628707 ATTGTATTATTGCTTTTTAAAAAGCCAAATGCCAACTTCTTAAAAGGATCAGGGCGGGTTGGAATCGCCGCGGGGACAGGCGGGCGGGACGCGCCGCAGTGTCCGTCTCCGGCTGTCAGAAATGCGGTGAGCTGAGATGAGCTGAGCTGGGCTAAGTTGCACCAGGTGACCTGAGCTGAGCTGGGCTTGGCTGCACTAAGTGGCTGGGCTGAGCGGGTCTGAGCGGGGCTGAGCTGAACTAGGCTGGGCC
Ig MYC AJ628708 GGCGGGGAAGTGTCCCCAAATGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGACCTGGCTGGGGTGACCTAGGCTGGGCTGCGCTGAGCTGGGCTGGGCTGGGCTGGGCTGAGCTGGGCTGGGCTGAGCTGAGCTGGGCTGACCTGGGCTGGGCTGACCTGGGCTGGGCTAAGCTGGACTGATCTGGGCTAGGCTGGGCTGGGCTGACCTAAGCTGAGCCAGACTGGGCTGAGCTGGGTG
Ig MYC AJ628710 CCCCCCACCCCAGCCCCAGTTACCATAACTACTCTGAGAAAAGTGTCAATAGCGCACTGGGGCCAGGGAACCCTGGTCACCGCTCTTAGGGA
Ig MYC AJ628711 ACCGGCTTTTATACTCAGCGCGATCCCTCCCTCCGTTCTTTTTCCCGCCAAGCCTCTGAGAAGCCCTGCCCTTCTCGAGGCAGGAGGGGAGCCAGGGACGGCCGGGGCCCGGCAGTGGCTTGAGCAGAGCTGGGGGCTGAGCTGGGCTGGGCTGGGCTGAGTTAAGCTGGGCTGACCTGGGCTGAGTTAAGCTGGGCTGACCTGGGCTGAGCTAAGCTGGGTTGAGCCGATCCGGGCTNNNCTGGGCTGG
Ig MYC AJ630033 TATTTAGGCATTCGACTCATCTCACCATTAAAGTGATAAAAAAATAAATTAAAAGGCAAGTGGACTTCGGTGCTGACCTACGCTGGGCTGGGCTGGGCTGAGCCGAGCTGAACTGGGCTGAGCAGGCTGTGTCGGGCTGAGCCAAGCTGG
Ig MYC AJ630038 TCCCTTTTCCCCTGCCTGCGCCTACCCAACACCACGTCCTAACACCTCTAGAGACCCAGGTTTACGCTGGGCTGGGCTGGGCTGAGCCGAGCTGAACTGGGCTGAGCAGGCTGTGTCGGGCTGAGCCAAGCTGGGCCGAGCTCAGCAGAGCTGAGTCGAGCTGAGTTTAGTTGGGCTGAGCTAACCAGGGCTGGGCTGAGCTGGGCTGAGTTGAGCTGAGCTGAACTGGGCTGAACGGGCTGAGGCGAGC
Ig MYC AJ630041 ATGCAAGGGGCTTTCTGCCCACCGCAAAGCAACCCCCAGCCCCCCAAAACCCAGAGAGCAATTGACCTGGGCTGAGCTGAGCTGAATTGGGTTGACCTGGGCTGAGCTGGGTTCGGCTGGGCTAGGCTGACCTGGGCTGGGCTGAGCTGAACTAGGCTTGGATGAGCTGAGCTGGGCTGGGTTGCACTGCGCTGGGCTGGGTTGGACTGGTCTGGGCTGACCTGAGCTGTACTGAGCTGGTCTGACCTGT
Ig MYC AJ630604 TTCCCTCTGCCTTCTCCTCTCCCATCTTGACAAGTCACTTTACCCCGATCCAGTTCTGGATTACCCCCCACCCCAGCCCCACCTGCAGGGAGGCTCGGCACTCCCTGTAAAGACGAGGGATCCAGGCAGCAACATCATGGGAGAATGCAGGGCTCCCAGACACCCCAGCCCTCTCGCAGGCCTCTCCTGGGAAGAGACCTGCAGCCACCACTGAACAGCCACGGAGCCCGCTGGATAGTAACTGAGTCAG
Ig MYC AJ630607 CCCCTCCATAAATACAGGGGGGGTGTCAAATAATAATAGGGGCACCTCCCTTCGCACTCAATACGTAGATGCTGAGCTGGCCTGGGCTGGGTTGACCTGGGCTGAGCTGGACTAAGCTGGGCTGACCTGGGCTGGGATGGGATGGGCTAGGATGACTTGGGCTGGACTGGGCGGGACTGAGCTGGACTGGCCTGGGCTGAGCTGGGCTGGGCTGGACTGACCTGGACTGGCCTGGGCTGGGCTGGGCGGG
Ig MYC AJ630610 GCAGCGGCGGGGAAGTGTCCCCAAATGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGCTCGGGTGTTGTAAGTTGGGAAGGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCT
Ig MYC AJ630613 TTCCCCTGCCTGCGCCTACCCAACACCACGTCCTAACACCTCTAGAGACCCAGGTTTTAAATTGTATTATGAGCTGAGCTGGGTTTGTTTGACATGGACTGAGCTGTGTTGAGCTGGGCTAGGCTAACCTAGGCTGGGCGGAGCTGAGCTGGGTTGGGCTGAGCTGAACTGGGCTGGACTGGGCTGGACTGGGCTGGGCTGGGCTGGGCTGGGCTGAGCTGAGCTGAGCTGTACTGAGCTGGCCTGGGCC
Ig MYC AJ630614 GCAATTAACACAATAAAGCAGCAATGTCCGACCGGCCGGGAGTCAGCGTGAATATATTCATAAGGCAGAAATGTCGAAAGGGTAGTCTTAAAAACCATTCCCGTTTTCCCTCTGCCTTCTCCTCTCCCATCTTGACAAGCTGAGCTAGACTTGCCTGAGCTGGGCTGGGCTGGGCTGGACTGACCTGGGCTGGGCTAAACTGGACTGATCTGGACTAGGCTGGGCCGGGCTGACGTAAGCTGAGCCAGAC
Ig MYC AJ630616 ATGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGCTCGGGTGTTGTAAGTTCCAGTGGGTGACTTAGCAGCCGTCTGCTTGCAGTTGGACTTCCCAGGCCGACAGTGGTCTGGCTTCTGAGGGGTCAGGCCAGAATGTGGGGTACGTGGGAGGCCAGCAGAGGGTTCCATGAGAAGGGCAGGACAGGGCCACGGACAGTCAGCTTCCATGTGACGCCCGGAGACAGAAGGTCTCTGGGTGG
Ig MYC AJ630618 TGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGCTCGGGTGTTGTAACTTTATCACAAAACAAACTGACAATAGGGAAGCACAATTTCCCAATGCTTTCAATATCACAGATCTCCCCGAGGACAGTCTGACATGCTCTGAGCCCCACTATCTCCAAAGGCCTCTCACCCCAGGGCTTACTATATAGTAGGTGATATGCAAATAGAGCCCTCCGTCTGCTGATGAAAACCAGCCCAGCCCTG
Ig MYC AJ630620 AAAAGTGTCAATAGCGCAGGAATGGGAGAAAAGACACCCTATTTAGGCATTCGACTCATCTCAGTTGGGCTGGGCCGGGCTGGGCCGGGATGGGATGGGCTGGGCTGGGCTGGACTGGGCTGGGACGGGCTGGGCTGGGCTGGGCTGGGACGAGCTGGGCTGGCCTGGGTTGAGTTGAGCTGAGCTGAGCTGAGCTGGGCTGGCCTGAGCTGGGCTGGGCTAGGCTGGGCTGGGCTGGGCTGGGCTTGGA
Ig MYC AJ630621 GCCGCCCGCTCGCTCCCTCTGCCTCTCGCTGGAAGGCTGGGACGAGCTGGGCTGGCCTGGGTTGACCTGAGGTGAGCTGAGCTGAGCTGGGCTGGCCTGAGCTGGGCTGGGCTAGGCTGGGCTGGGCTGGGCTGGGCTTGGACGAGCTGGGCTGCCCTGGGTTGAGCTGAGCTGAGCTGAGCTGGGCTGGGGTGAGCTGGGCTGGGCTGGGTTGGGCTGAGCTAGACTGGGCTGGGCTGGGCTGGGCTGA
Ig MYC AJ630622 GGCTGCGGAGCGATCTGGCTCACACAGGCGATATGCGGTCCCTACTCCAAGGAGCTCAGGATGCAAGGGGCTTTCTGCCCACCGCAAAGCAACCCCCAGCCCCCCAAAACCCAGAGATCTGGGCTAGGCTGGGCTGGGCTGACCTAAGCTGAGCCAGACTGGGCTGAGCTGGGTGACCTTAGGTGGATTGAACTGGACTG
Ig MYC AJ630625 TGCCAACTTCTTAAAAGGATCAGGGCGGGTTGGAATCGCCGCGGGGACAGGCGGGCGGGACGCAAATGAACAGCCTGAGAGCCGAGGNACACGGCTGTGTGTTATTGNGCGAGGGGGGGCGTGGCTGATGACAGCAACTGCCGTACATACCTAGGAAGCGCGATTAGTAGNTTCCCTACGGTATGGACGTCTGGNGCCAAGGGACCACGGTAACCGTNTCCTCAGTAAGATTGGCCACTCTAAGGGCTTT
Ig MYC AJ630627 CCGGGGCCCCTCCGCTGCGGCTGTTCCCACTCGCGCCCTAGCCGCTCTCCTACCCCCGCCGGCACCGCAGCCCCTCCCAACCTTCCCTCTCCACCNNNCCCGTCCCCACCCCCACTGAGCTGGTCTGACCTGTGCTGAGCTGGGCTGGGCTAGGCTGACCTGGACTGACCTGTGTTGGGCTGGGCTGGGCTAAGCTGGGCTAGGCTGGGCTGAGCTGGACGGAGCTGACCTGGATGAGCTTAAGTGGACT
Ig MYC M30444 TCCAGATGGCCAGGCTCATTCTGGGCCTTTTTCCCCACAATCCCCAGGCCCAGGGCGGCTCCCAGGGCCCCCATTCCCCCACCAGAAGCTGTTGCTCAGCCACTATCATCAGGCTGGGCGCAGCTCCTTGGAGTAGGGACCGCATATCGCCTGTGTGAGCCAGATCGCTCCGCAGCCGCTGACTTGTCCCGTCTCCGGGAGGGCATTTAAATTTCGGCTCACCGCATTTCTGACAGCCGGAGACGGACACTGCGGCCGGTCCCAGCCCGCCTGTCCCCGCGGCGATTCCAACCCGCCCTGATCCTTTTAAGAAGTTGGCATTTGGCTTTTTAAAAAGCAATAATACAATTTAAAACCTGGGTCTCTAGA
Ig MYC X00252 AGCTCGGCCCAGCTTGGCTCAGCCCGACACAGCCTGCTCAGCCCAGTTCAGCTCGGCTCAGCCCAGCCCAGCCCAGCGTAGCTCAGCTCCCGGCCGGTCGGATATTCCTGCTTTATTGTGTTAATTGCTCTCTGGGTTTTGGGGGGCTGGGGGTTGCTTGCGGTGGGCAGAAAGCCCCTTGCATCCTGAGCT
Ig MYC X63555 TCCTTGCAGCTG
MIR142 MYC 2682663 TAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTGTAGTGTTTCCTACTTTATGGATGATGCTTAGACGCTGGATTTTTTTCGGGTAGTGGAAAAACCAGGT
MIR142 MYC M31826 TAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTGTAGTGTTTCCTACTTTATGGATGaTGCTTAGACGCTGGATTTTTTTCGGGTAGTGGAAAAACCAGGTAAGCACCGAAGTCCACTTGCCTTTTAATTTATTTTTTTATCAC
MYC Ig 15496980 aGACGCTGGATTTTTTCGGGTAGTGGAAAACCAGGTAAGCACCGAAGTCCACTTGCCTTTT
MYC Ig 17541401 aaaaggcaagtggacttcggAgttgtactgagctggcctg
MYC Ig 17541401 cccctattcgctccggatctAagttgcaccaggtgagctg
MYC Ig 17541401 ccgcgagcagcacagctcggCcgcatgtgagcaggggcag
MYC Ig 17541401 gctgcaaggagagcctttcaGctgagctggactgggctag
MYC Ig 17541401 ggccgcgagcagcacagctcAagatcatccgcaggtgagc
MYC Ig 17541401 ggttttaaattgtattattgGcttttgagcaggggcaggt
MYC ZBTB5 17230227 atcgttattcatgtatatcttatttccactaaagtttaagcagcacatcagatataaacaaatgaatgaatgaataaatggatgtatgtgcatatagtttaagtttctacttcctgggactgtcagtctttttcaccccactcagtcctatgctgcc
MYC ZBTB5 17230227 attgctagattccttgtgggcaaagactatgtctttctctttcataactatatcctgaagaccaggcatgatgtccagtcgcttaaccttgaacaagtaagcactttaaaacattagatgatgctggcatggtggctcacacttgtaatctcagcac

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)