TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'MLLT3'. The HGNC name for this gene is 'MLLT3'.

27 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
KMT2A MLLT3 11066077 CCGCCCAAGTATCCCTGTAAAACAAAAACCAAAAGAAAAgTCTGAACAACCCAGTCCTGCCAGCTCCAGCTCCAGCTCCAG
KMT2A MLLT3 11066077 GTGAGCCCAAGAAAAAAGCAGCCTCCACCACCAGAATCAgTCTGAACAACCCAGTCCTGCCAGCTCCAGCTCCAGCTCCAG
KMT2A MLLT3 15381384 AGTAGTGGGCATGTAGAgTCTGAACAACCCAGTCCTGCC
KMT2A MLLT3 15381384 ATCAGAGTGGACTTTAAgTCTGAACAACCCAGTCCTGCC
KMT2A MLLT3 18000862 caccaccagaatcagGTCCTTTGAGGTCTATAAT
KMT2A MLLT3 9331569 CTTTCTATTTCCACTGGtCTTAGCAAATAAAATAAAC
KMT2A MLLT3 9331569 GCACTTTGGGAAGCCGAAGCAGgATGACTCTCCTGTGTTAGTA
KMT2A MLLT3 9844920 AGGTGTGGTGGCACGCgCCTCTGCTAGCATCAAACTTT
KMT2A MLLT3 9844920 CATACTTCTATCTTCCCATGTTCTTACTtTGGACAAAAGTAATACTCTGTAAAAT
KMT2A MLLT3 9844920 CTATTTTTATTTATTATGGATAAAGAGATAGTgTTGAGACTCAAATGATTAAAGTC
KMT2A MLLT3 9844920 TGTGCCAGTAGTGGGCATGTAGAGGTAAGGCATCCTGCTTCTTTGTACCCcATACTGTTGTACCTCTAACAAGAAAACATGATACTT
KMT2A MLLT3 AM050804 TAACAAATAAAATACATATACACATTTTACCTGTAGATACACATGTATCTAAAAATTTGAGAACAAGTTGCAGACATAAACCATTTTACCTCTAAATATTTTAGTGTATATTTTTAAAAATCAAGGACGTTCTCGTATTTAACCATGGTATAATTACCAAATCAGGAAATTAACACACTGGTACATTACTATTATCTGATCTATAGGCCTTATTTAGGTTTGACCAATTGTCCCAATAATTCCTTTATGGCAAAAGAAAATTCTGGATTATCCTAGTTAGTATTTTTGAAAATCCTATATCAATATGAAAATAACCCTTATAATGAGAAAATGTTGCATTTTTGACCTGGTGAAGATGAGGTAGTCTTAAGTCAACACTTTTTCCCCAGTGGATTTTGGTTATATTAAAAGTCAAACTACCATGGACATAAGTTCTTAGCAAATAAAATAAACTCTTAATGCCACTGCCATGATAGTAAATCCAGGTTTCACATTTAATCGGGAAAATTCTGTAAGATAGTCCAAAGATTAAAATTAATACTTCTTGACATCTGTGTAAATCTGTAAAGATTATATTGGTGTCAATCAAATGCTTTATGAACATTTTAAAGTGACACATTTTTTAAAAGGTTAAAGTTAATAAGGAAATGTAGTTAAATGTCTTGTCAAAATAATCTCTT
KMT2A MLLT3 AM050804 TATTTTTGAAAATCCTATATCAATATGAAAATAACCCTTATAATGAGAAAATGTTGCATTTTTGACCTGG
KMT2A MLLT3 AY282392 AAATAAAATACATATACACATTTTACCTGTAGCTCATCTCTCAGATTTTATAAAATTAAAGAGAATTAGGGCT
KMT2A MLLT3 AY282393 TTGCATTATTATCTGTTGCAAATGTGAAGGCAAATAGGGTCTTGTTACTCTTAGTTTTCTATGCTCTTAAAATAGTTTTACCTGTTCTTGTTAGATTGGCACTTAAAAAATGCATGACTAATTACTACATAATTGAAAAA
KMT2A MLLT3 AY282394 AAATAGGAAGCAGTAGTTTGTCATTTATAAGGGACAGTATATATTACCTTATTAAAATAT
KMT2A MLLT3 AY282395 TTCTGTTAAATCTTGTATTATATTTATTTTGTTACTTTCTATTTCCACTGGTATTAATTGGAGGTCACAGTAAGCAAGTTGCATAAATTGGATTTCACTCTTACCTGCCCGGGCAGCCCCTTGCCTTTGTGTTGGAGTAC
KMT2A MLLT3 AY282396 AGCATGTTCTGATAAATCTTGTATTATATTTATTTTGTTACTTTCTATTTCCACTGGTATTACGATAGGTAATTAGAATTCTGCTGTCTGGTGTCAGACAGGCTGTGTCTTAAATTTCAGTGCCACTAGGGATCTTGGGC
KMT2A MLLT3 AY282397 TTCAAAGATTATTTGTTTTTAGTCGTATTTGAAT
KMT2A MLLT3 AY282399 TTTTGTTACTTTCTATTTCCACTGGTATTACGGCTTTATTGTTGTTGCTATTGGTTCAATACTTGAAAAGTAGGTAGCGTAACAGAAGAG
KMT2A MLLT3 AY282400 TGTTACTTTCTATTTCCACTGGTAGTATATATTACCTTATTAAAATATACCTT
KMT2A MLLT3 AY282401 TTTGGTTTCCCAGTGCATATAAAAGTTATATTTATGCTATATGGTAAATAATCTTTCTGAGTTTTTTGCAGTATGTACCACCTTTACAATGAGGAAGGAAAAAGTAGCACAATTTTAAATAGGAAGCAGTAGTTTGTCGT
KMT2A MLLT3 AY282402 TTGTATGTCTGGCTGGTGTTTGAGGGATCGATCACTTATTTGTTGATAAGTGAAAGGTAGGTAGATATTACCACTTTAGTACTCTGAATCTCCCGCAGGTGTCCAATACTGTACTTTTTTACATAGTCATTGCTTAATGA
KMT2A MLLT3 AY282403 ATGCTATCCCTTTAAGTCAAGCTTCTGGGACTTAAAAAAAAGACCCAGTCTCTTTTTTCAAAGATTATTGTTTATGTTGGAAACATGTTTTTTAGATCTATTAATAAA
KMT2A MLLT3 AY282404 ACAAAATGATTTTGCATAGCCATTTAATGTTGAAGATTGTATTGCAAATCCTGGTAGGCCCTTTAGTACTCTGAATCTCCCGCAATGTCCAATACTGTACTTTTTTAC
KMT2A MLLT3 AY282405 CTATATGGTAATCTATTAAGTGTGACAGTAAGTACTCTGAATCTCCCGCAATGTCCAATACTGTACTTTT
KMT2A MLLT3 S82034 TCTCTGTGCCAGTAGTGGGCATGTAGAGGACCCTAATAGGAGTATTCATACCAGCAGCAG

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)