TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'MLLT1'. The HGNC name for this gene is 'MLLT1'.

50 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
KMT2A MLLT1 17145626 aaaccaaaagaaaagGaggagccgaggaag
KMT2A MLLT1 17145626 agagtggactttaagGacgccaacaaggag
KMT2A MLLT1 17145626 agtgggcatgtagagGacgccaacaaggag
KMT2A MLLT1 17252016 AAAGAGGAAATCAGCACCAACTGGGGGAAGGATTGAGTGCCTTCTCATCGCTTTGTCAT
KMT2A MLLT1 17252016 ACATAAATTATTTTTCTGTGGATGAAATTCCTTTTGAACTCATGGAGGGGCAGAGAATA
KMT2A MLLT1 17252016 ACATTCCTATCCATCCTGAGCAGTATCACAGAGCGTCTCAGACTTGAGGAAATACACGC
KMT2A MLLT1 17252016 ACGAGCCCACAAGGTCTAGGCTGCAGTGAGGGGAGTGTGGCTGTTTGGGGCGGTAAAAC
KMT2A MLLT1 17252016 ACTTTAGTACTCTGAATCTCCCGCAGTGTCACCAGCCTGGCCGACATGGTGAAACCCCAT
KMT2A MLLT1 17252016 AGATTTTAGGAAGGAATCTGCTATTAGAGTTGGACCCAAAGTCTGATTCTAGCTTCCCC
KMT2A MLLT1 17252016 ATACTTCTATCTTCCCATGTTCTTACTATACCGAACTTCGCATCTGTTGGCCAAGTCTGG
KMT2A MLLT1 17252016 ATGGGAGGCTTAGGAATCTTGACTTCTGTCCAATGAATGTGTGTGAAGTCCTTAGCATA
KMT2A MLLT1 17252016 CAAAGACTTTAAATAAAGAAAATGCTACTAGTTCACAGCTGAGAACAGCAGAGTCCCAGA
KMT2A MLLT1 17252016 CACGCCTGTAATCCCAGTACTTTGGGAGGCTTTCGTGGGGACCCTTCTGCAGGGTGGAG
KMT2A MLLT1 17252016 CAGATCAGCCTGGGCAACATGGTTAAACCCTTAAAGTATATATCTAGAAAACAATCTGGA
KMT2A MLLT1 17252016 CATGGGTGGGAGCGGCCACCAGGAGGGCTAGACCTTACAACTGTTTCGTATATTACAGA
KMT2A MLLT1 17252016 CTCCAGCCTGGGCGATACAGCGAGACTGCGTTCATTTCAATATTGCTCATAATAATAAA
KMT2A MLLT1 17252016 CTGCACTCCAGCTTGGGTGACACCGAGATTCGAGCGTCTCAGACTTGAGGAAATACACG
KMT2A MLLT1 17252016 CTGCAGAACATACATAATGAAACATTCCTGATGCTGGCGCCACTGAAGTGGCACTGTCT
KMT2A MLLT1 17252016 CTTTAGAGTTTTTATCTGGACTTACTTTCATATCTAGAAAACAATCTGGAAGGATTCAC
KMT2A MLLT1 17252016 GAAGAATCGCTTGAACCCAATTGGCGGAGGAATAAAAATTAAAACAATTAAAAAAATAAA
KMT2A MLLT1 17252016 GAATCTCCCGCAGTGTCCAATACTGTCCCTAATATCCCCAGACCTTTGAGTCACTGATG
KMT2A MLLT1 17252016 GAGGCCAGCAGTTCAAGACCAGCCTGGGCATGGCCTCTGCCTTCTTCTTGGGAACCTCCC
KMT2A MLLT1 17252016 GAGGGGACTGGGACGTGACAAGGATAAGGCAGAGGTAAGGCATCCTGCTTCTTTGTACCC
KMT2A MLLT1 17252016 GCAAGACCCTGTCTTTATTTAAACAAAATCCTTTGCCCATCCAGTAATTTATCCAACGA
KMT2A MLLT1 17252016 GCTTGCAGTGAGCCGAGATCGCCCCACTGCTATGCAGGTTTGTTACATAGGTAAACGTGT
KMT2A MLLT1 17252016 GGCAGCGGATCACAAGGTCAGGAGATCCAGTATTTCTTTTGTCTCCGGCCTGATCCCAGG
KMT2A MLLT1 17252016 GGCTCCCCTCGGCTGAGATAGAAGGATTGCCTGAGCTGCCTTGTATTTCAGAGCAAAGT
KMT2A MLLT1 17252016 GGGGGTTTTATTGGGTCTCATGTTGCCGTCTAGTGAGCTATGATTGTACCACTGCAGTCC
KMT2A MLLT1 17252016 GTCTACTGTATCCTCTTTTCCGTCTTAATAGTTAGAGTTCTTTTATATAAACATCACAC
KMT2A MLLT1 17252016 GTTTTGTTGGTATTTAGCAGGTACTATTCCTCATCCACCCACCCTTTAATTCATCTACCC
KMT2A MLLT1 17252016 TAAATAGGAAGCAGTAGTTTGTCATTTATATGGGTATATACCCAGTAATGGGATTGCTGG
KMT2A MLLT1 17252016 TATCTAAAAATTTGAGAACAAGTTGCAGACAAAAAAAAGAAAATACAAAAATTAGCTGA
KMT2A MLLT1 17252016 TATTATCTGATCTATAGGCCTTATTTAGGTATACTTTGTATCTGTTATACAATTTTTCA
KMT2A MLLT1 17252016 TCAAAAAAATAAATAAATAAAAATTAAAACCAAGTCTGGGGTGTGTCCTTAACAGTGGG
KMT2A MLLT1 17252016 TGCGTGTAGTCCCAGGTACTCAGGAGGCTGGCTGTGCTAATAAATTATCATGACCTGACA
KMT2A MLLT1 17252016 TGTGGAAATGCAGGCTCAGAAGTCCTACCATATAGTTTGTGTATTGCCAAGTCTGTTGTG
KMT2A MLLT1 17252016 TTAGGAAGGAATCTGCTATTAGAGTAGCATGATCTCCTGGGTTCAAGCGATCCTCCTGC
KMT2A MLLT1 17252016 TTATTTTGTTACTTTCTATTTCCACTGGTATCTCCACCCATCCCCTACCTGGACCTGAG
KMT2A MLLT1 17252016 TTCAGTGATCATAAAGTATATTGAGTGTCAGGAACCTTCCTGTTTACTTTGGCCACTGCG
KMT2A MLLT1 17252016 TTCATTTACTAAGCAAATATTCTCTTAGAACAAGGCCATTAGGACAGCTGAATCAATCC
KMT2A MLLT1 17252016 TTCCCATAGCTCTTTGTTTATACCACTCTTAACCTCTGCAGCCAGGCACCCTTCCTAGA
KMT2A MLLT1 17252016 TTTTCCATCCAAAGTTGTGTAATTGTAAAACAGCCGGGCGTGGTGGCTCACGCCTGTAA
KMT2A MLLT1 20113834 gtccacaggatcagagtggactttaagTgcaccgtccaggtgaggttagagct
KMT2A MLLT1 20113834 tctctgtgccagtagtgggcatgtagagTgcaccgtccaggtgaggttagagct
KMT2A MLLT1 AM050746 AGCAGAGCAAACAGAAAAAAGTGGCTCCCCGCCCAAGTATCCCTGTAAAACAAAAACCAAAAGAAAAGGTGAGGAGAGATTTGTTTCTCTGCCATTTCTCAGGGATGTATTCTATTTTGTAGGGAAAAGCCTTATCCTTGACTTCTATGTAGATGGCAGTGGAATTTCTTAAAATTAAGAAACTTCAAGTTTAGGCTTTTAGCTGGGCACGGTGGCTCACGCTGGTAATCCCAACACTTAGTGAGGCTGAGGTGGGAGGATTGCTTGAGGCCAGCAGTTCAAGACCAGCCTGGGCAACATAGCAAGACCCTGTCTTTATTTAAACAAAAAAAAAAAAAAGAAGAAGAAGAAGTTAGCCAGGCATGGTGGCAGTTGCGTGTAGTCCCAGGTACTCAGGCTCCCCTCGGCTGAGATAGAAGGATTGCCTGAGCTGCCTTGTATTTCAGAGCAAAGTGTCAGACACGACATGTGCTCAGCGGAGGGAGCTGGGCTGCCCAGGCCACGGGTCCACCTGGGACCGGTCACCAGGGGGCCGCAGGCTGGCCTCTGCCTTCTTCTTGGGAACCTCCCATTCTGCTTTTGAAACTGAAAGCCAGTGTTGTAGCTGATGACTTAGGGAAAGGAGAGGGGCCTCCGGGAGGCGCTGTGATGCGTGCTTGGGAATGAAAATGCTGGAGTCAACAAGCTTAGGTGGCAGAGACACCGACAGCCATCAGCAAGATGACTTTTGATAGTGAAAGTGCTCGGA
KMT2A MLLT1 AM050746 GTGTAGTCCCAGGTACTCAGGCTCCCCTCGGCTGAGATAGAAGGATTGCCTGAGCTGCCTTGTATTTCAGAGCAAAGTGTCAGACACGACATGTGCTCAGCGGAGGG
KMT2A MLLT1 AM050798 CCATTTCACAGATGTGGAAATGCAGGCTCAGAAGTCCTACCATATAGTTTGTGTATTGCCAAGTCTGTTG
KMT2A MLLT1 AM050798 GAGCGAGTTCCCTGCTCACTTAAGGGTTATGTCTGGAAGGAGTGTGGTTTGTTTCCTGGGCTGGGGCCGGGGGGAGGGGACTGGGACGTGACAAGGATAAGGCTGAGCAGATGCCGAAAAGAGATTGGGAAAGGGCCTGAGAGCAGGTCACGGGGACTGGGGCTGCCTAGGGAGCTGGGAGGTGGTGTCAGCATCTGGGCGGTCACGTTCTTCAAAAGGACCAGGGAGCACCCCCACGCTCGAATTGCTGCTTGCTGGTCCTGCAGATGCTCTCCTAGGTTTGGGTTTGAGAGCAGCTGCCTCACAACGATGTTCTTCAGCGGGGAAAGTTTGTTTCTGATGCCAGGGGCCCATTTCACAGATGTGGAAATGCAGGCTCAGAAGTCCTACCATATAGTTTGTGTATTGCCAAGTCTGTTGTGAGCCCTTCCACAAGTTTTGTTTAGAGGAGAACGAGCGCCCTCTGGAGGACCAGCTGGAAAATTGGTGTTGTCGTCGTTGCAAATTCTGTCACGTTTGTGGAAGGCAACATCAGGCTACAAAGGTACAAAACTTGGTAATAGAACTACAGCTGGGCCTCTGTATCAGTGGGTTCTGTATCCCTGGACTCAACCAACCTTGGATTGAATGTATCTGGGAAAAAATGAGTAGTTGCCTCTGTACTCTATGTGAACAGACTTTTTCTTGTCATTATTTCCTAAACAATACAGTATAACAACTATTTACATTGTATTAGGTATGATAAGTAATCTAGAGATAATTTAAAGTATATGGTGGGCGGATCACTTGAAGCCAGGAGTTCGAGACCAGCCTGAGCCAACATGGTGAAAC
KMT2A MLLT1 AM050801 TATATTACAGAAAACGTTTAAACCCTCCCTATTTCCCCCACCCCACTCCTTTATATTCCCATAGCTCTTTGTTTATACCACTCTTAGGTCACTTAGCATGTTCTGTTAAATCTTGTATTATATTTATTTTGTTACTTTCTATTTCCACTGGTATTACCACTTTAGTACTCTGAATCTCCCGCAGTGTCCAATACTGTACTTTTTTACATAGTCATTGCTTAATGAATATGTATTGAATTAAATATATGCCAGTGGACTACTAAAACCCAAAGTATATAAGAAGGGTATGGTTGATTATGTTTTTCTACATATTATTTGACATACTTCTATCTTCCCATGTTCTTACTATACCGAACTTCGCATCTGTTGGCCAAGTCTGGGGTGTGTCCTTAACAGTGGGTGTTGAGGCTCAAGTTGGCGCCAGCCCCCAGGGCATCAGTGTCGCCTGGGCAGCACTTTGGGCCCGGCCTGCCGGCTGCAAAGATTACCCATCGCTGCCTCGGAACCTTCCTGTTTACTTTGGCCACTGCGGTGGAGTTCTGGTGCTTCCATCCTCCCCCTCTCCAGTGGAACCGCGGTCTTTCACTCTTTCACAATAACTGCTCTGCCGCCTGCGTGCCCTGGGTAGGAACTCCCTGTCATCAGAAATGCCGGGAAGTCGGCCGAGGTCTGAGTGGCCGG
KMT2A MLLT1 AM050801 TTTGACATACTTCTATCTTCCCATGTTCTTACTATACCGAACTTCGCATCTGTTGGCCAAGTCTGGGGTGT

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)