TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'MALT1'. The HGNC name for this gene is 'MALT1'.

4 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BIRC3 MALT1 17339192 gaaaaagaatcaaAtgaattaaataatctt
BIRC3 MALT1 17339192 gaaaaagaatcaaGaagtgttgatggcgtc
BIRC3 MALT1 AF123094 CCTAGCAACTGGAGAGAATTATAGACTAGTCAATGATCTTGTGTTAGACTTACTCAATGCAGAAGATGAAATAAGGGAAGAGGAGAGAGAAAGAGCAACTGAGGAAAAAGAATCAAGAATAAAGATTACTGTAAACCCAGAGTCAAAGGCAGTCTTGGCTGGACAGTTTGTGAAACTGTGTTGCCGGGCAACTGGACATCCTTTTGTTCA
MALT1 MAP4 16804917 ACTGACCAGCCTTTggGAATAGCCAGGCCAGAA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)