TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'KAT6A'. The HGNC name for this gene is 'KAT6A'.

16 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
KAT6A ASXL2 AB084281 ATAGTGTCCAACTCTGTGGTCTCAGAGGAGGAAGAAGAGGAGGCTGAGGAAGGAGAAAACGAAGAGCCACAGTGCCAGGAAAGAGAATTAGAGATCAGTGTCTTAGAAAAATACCCCAATACACCCATGAGTCATAAAGA
KAT6A CREBBP 12378533 TCCGAAGAGGAGCAGCCTTCCCATGACACGTCCGTGGTGTcCATCGTTGCGATGGGAATAACTGGGAACACAAGTCCATTTGGACAGCCCTTTAGTCAAGATGGAGGGCAGCCAATGGGA
KAT6A CREBBP 12461753 ACACTAAAATAGTACCCCTGATTAAGTTCCCATGGACTTAGATTTTTGCTGATGCAGCCATTTCCTTTGTTGACTTTCaATTGGGCCTAGTGGAGCAGGGTGTGTGCCCGGTGCATGTGATCAAATTTGAGGGAGGGGACCTCTGTCTAGGAGCTGAGGGGTTGAAAGGAGGAGGAGCCC
KAT6A CREBBP 12461753 ACTTTGTCTGTTGTAACTGCTCCACTAAGAAATTGAGTAATGAGATGGACAGAGATGTTGACTTTCAAGTTACTACTACTAACTGTGCCTTTTTAGCCGTGCCCCCACTGCATCATGTTCTTGTCTTGGGATTCTTATTCTTTAA
KAT6A CREBBP 12461753 ATTATTGGATGATCAGATGCTTAATAAGTTGATCAGAAAGGATTTTCCACACTTAACCACCTTTTCCCCCTTCCTTTACAATTTTGATCCTTGTAAGGCaGATTGGTTCTGACTAGTGTCTGATAACATAATGTTGACCAGGATTCTTTCATAGTTCTGCCAATTCACTGTGTGACTTAG
KAT6A CREBBP 12461753 GACAATCAGGAGTTTATAAAAGTAATGATTAATAAAGTCATTTCTATTGTATATGCTAGTCTTGGAAGAAGGAACTAGAAAATGTAAGACCTTGTAACCtTATGCAGAGATGATGCAGAAATACGGAATGTGCTGCGAATGAGGGTAGCAAGAGAGAAACGGTACCTTTCACCCCACTGA
KAT6A CREBBP 12461753 GAGTAACTTCCCACAGACATGCAGCTGATGATGGTAGTCTtGAGTTTGACGTTAATCTTATAAAATGAACTTATTGA
KAT6A CREBBP 12461753 GGCTGTGGCAGGAGGATCGCTTGAGCCCAGGAGGTCGAGGCTGCAGTGAGCTGTGATCATGCCACTGCACTCTGGCCTGGGTGACAGAGtACCCAGGTGGGAGTGCAGTGGCACAGTCTCAGCTCACTGCAACCTCCACCTCCGGGTTCAAGCGATTCTCGTGCCTCAGCATCCCAAGTA
KAT6A CREBBP 12461753 GTTGCAAACAGCACTCCCGAAGGTCATGCAGCACCTCAGAGTGATGAATGTCACTGCCACTGATGACAAACAAGTTGCCGAAGCCTGGGAAGCtAAGAACCCGCTtTTGTTTTTTTTCCTTCCTGTATAG
KAT6A CREBBP 16193081 gagtcagatgatgctgatgaTtttggatcattgtttgacttgc
KAT6A CREBBP 18698081 gatgatgctgatgCCATCCTGGGGTCT
KAT6A CREBBP 18698081 gatgatgctgatgGAAATAATCCAATGA
KAT6A CREBBP 8782817 AGTTGCCTCCAGTATTCAGCACAGTAACAAGCTGTACCtCTTCAGTGACCTGGGCAGCATTGAGAGCACCACTGAAAACTATGAGA
KAT6A CREBBP 8782817 GACCACTCTCAGCAGGTGGTGGaGGAGATGGGAATAACTGGGAACACAAGTCCA
KAT6A NCOA2 9731070 TCAGATGATGCTGAtGGAATGATTGGTAAC
KAT6A NCOA3 17805331 gaagaagatgaagagtcagatgatgctgatgGAGACTGGGGCTTACCAAACTCAAAGGCC

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)