TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'JAK2'. The HGNC name for this gene is 'JAK2'.

18 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BCR JAK2 16001431 catggagacgcaGattatgaacta
BCR JAK2 18503828 gtgaaactccagactgtccacagcaCGGGAGCAGCAGAAGAAgtcattgaatataaacactgtttg
ETV6 JAK2 9326218 AGTGGGACAAAGAAGAACTTCAGCAGTCTTAA
ETV6 JAK2 9326218 TTGATAACCTCAAACATATgGACAATCTGTATGTTGTGTC
ETV6 JAK2 9326218 TTTTTAAATATAACAAAAGCATACAGAGTGAT
ETV6 JAK2 9360930 ATGCCCATTGGGAGAATAGCAgATAAATCAAACCTTCTAGTC
ETV6 JAK2 9360930 ATGCCCATTGGGAGAATAGCAgATTATGAACTATTAACAGAA
ETV6 JAK2 9360930 CTGCATCAGAACCATGAAGAAgTTCTTCAGGAGAGAATACCA
PAX5 JAK2 19020546 cgcaagagagacgaagATTATGAACTATTA
PCM1 JAK2 15805263 GaatctccagtgttagtgaatgactatCgagaaaatgtcattgaatataaacac
PCM1 JAK2 15805263 agtgagagccttgctactactgatgatGaaattgaacttagctcattaagggaa
PCM1 JAK2 15805263 gaatctccagtgttagtgaatgactatGaaattgaacttagctcattaagggaa
PCM1 JAK2 15805263 gaatctccagtgttagtgaatgactataaaaatctctgtCactgtttgattaca
PCM1 JAK2 16034466 actcagctgaaaagcagagttaaaaacatcaAtaaatcaaaccttctagtcttcagaacgaat
SEC31A JAK2 21325169 gcgtcccaaagaacagTtcttcaggagaga
SSBP2 JAK2 18618714 cattcttggtggtgCGAGAAAATGTCATTGAATATAAACACTGTTTGA
SSBP2 JAK2 18618714 ccagggttctttcagCGAGAAAATGTCATT
SSBP2 JAK2 18618714 gccttccatgattacCGAGAAAATGTCATT

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)