release 3.3 (August 2013)
Department of Biochemistry and Genetics

You have searched for 'Immunoglobulin'. The HGNC name for this gene is 'Ig'.

100 record(s) found.


Click on an HGNC name to search for that gene.

Ig FCGR2B AF209720 ctcagagcatctttgtgtatgctttctgtgggcccagtctgccctgactcaacctgcctc
MYC Ig 17541401 aaaaggcaagtggacttcggAgttgtactgagctggcctg
MYC Ig 17541401 cccctattcgctccggatctAagttgcaccaggtgagctg
MYC Ig 17541401 ccgcgagcagcacagctcggCcgcatgtgagcaggggcag
MYC Ig 17541401 gctgcaaggagagcctttcaGctgagctggactgggctag
MYC Ig 17541401 ggccgcgagcagcacagctcAagatcatccgcaggtgagc
MYC Ig 17541401 ggttttaaattgtattattgGcttttgagcaggggcaggt

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)