TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'Ig'. The HGNC name for this gene is 'Ig'.

100 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BCL2 Ig 2284100 AATAAATAAATAGTTATCAGCCCCTGCCGCTGGAAAAAAAAAAAAGTCCCAGCAGATCAGCTGGCCGCAATAGTATTGAATGAATGATGCTGACTCTAc
BCL2 Ig AY137970 CTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGAAGCCACGGCCCTTTAGGATCCCCCATTGGTTCCTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACC
BCL2 Ig AY137971 GTGTCACTGTGGTATTACGATTTTTGGAGTGGTTATCAGGGTAGGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATTTTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTG
BCL2 Ig M13418 CACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGGTGCGTGGTTGATGGGGATTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTGAGTCCTCACAACCTCTCTCCTGCTTTAACTCTGAAGGGTTTTACTGCATTTTTGGGGGGAAA
BCL2 Ig M13419 CACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCCCCAGGGAACCCTGGTCACCGTCTCCTCAGGTGAGTCCTCACAACCTCTCTCCTGCTTTAACTCTGAAGGGTTTTACTGCATTTTTGGGGGAAA
BCL2 Ig M13420 TTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGAAGCCAGACCCCCGAGTGAAGACTACTACTACTACTACATGGACGTCTGGGGCAAGGGACCACCGGTCACCGTCTCCTCAGGT
BCL2 Ig M13421 CACAGACCCACCCAGAGCCCTCCTGCCCTCCTCGATACGGTATGGACGTCTGGGGCCAGGGGACCACGGTCACCGTCTCCTCAGGTAGGAATGGCCACTCTGGGGCCTTTGTTTTCTGCTACTGCCTGTGGGGTTTCCTG
BCL2 Ig S79218 TTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTTGATACTACTACTACTACTACTACATGGACGTCTG
BCL2 Ig X63225 GGTTTAGAATGAGGTCTTGTGCACTGTGGTATTACGATATTTTGACTGGTTATTCGTGAGGGAGGGTGGCCCTGGGGGGGCAAAATGTAGCGGGGGCTTTCTCATGG
BCL2 Ig X63226 CCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGGCTTCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACCCAGGCGGTGTTTGAAGACCCTTGACTACTGGGCCAGGAACCTGTCACCGTCTCCT
BCL2 Ig X63227 CCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTAGGTTCGGGGAGTTATTATAACCACAGTGTCACAGAGTCCATCAAAAACCCATCCCTGGGAGCCTCCCGCCACAGCCCTCCCTGCAGGGACCGTACGTGCCATGTTAGGATTTTGATCGAGGAGACAGCACCATGGGTATGGTGGCTTTGACTACTGGGGATC
BCL2 Ig X63231 GGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACTATGGTTCGGGGCTTACCTCCACCAAGAAAGCAGGAAA
BCL2 Ig X63232 CCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTAGGTTCGGGGAGTTATTATAACCACAGTGTCACAGAGTCCATCAAAAACCCATCCCTGGGAGCCTCCCGCCACAGCCCTCCCTGCAGGGACCGTACGTGCCATGTTAGGATTTTGATCGAGGAGACAGCACCATGGGTATGGTGGCTAAAGGATTGACTACTGGGGATC
BCL2 Ig X63233 GGTTTAGAATGAGGTCTTGTGCACTGTGGTATTACGATATTTTGACTGGTTATTATAGGTTACGCTCCACCAAGAAGCAGG
Ig BCL11B AY752976 ATGTCCCGCCGCAAACAGGGCAACCCGCAGCACTTGTCCCAGAGGGAGCTCATCACCCCAGAGGCTGACCATGTGGAGGCCGCCATCCTCGAAGAAGACGAGGGTCTGGAGATAGAGGAGCCAAGTGGCCTGGGGCTGATGGTGGGTGGCCCCGACCCTGACCTGCTCACCTGTGGCCAGTGTCAAATGAACTTCCCCTTGGGGGACATCCTGGTTTTTATAGAGCACAAAAGGAAGCAGTGTGGCGGCAGCTTGGGTGCCTGCTATGACAAGGCCCTGGACAAGGACAGCCCGCCACCCTCCTCACGCTCCGAGCTCAGGAAAGTGTCCGAGCCGGTGGAGATCGGGATCCAAGTCACCCCCGACGAAGATGACCACCTGCTCTCACCCACGAAAGGCATCTGTCCCAAGCAGGAGAACATTGCAGGGCCGTGCAGGCCTGCCCAGCTGCCAGCGGTGGCCCCCATAGCTGCCTCCTCCCACCCTCACTCATCCGTGATCACTTCACCTCTGCGTGCCCTGGGCGCTCTCCCGCCCTGCCTCCCCCTGCCGTGCTGCAGCGCGCGCCCGGTCTCGGGTGACGGGACTCAGGGTGAGGGTCAGACGGAGGCTCCCTTTGGATGCCAGTGTCAGTTGTCAGG
Ig BCL11B AY752977 ATGTCCCGCCGCAAACAGGGCAACCCGCAGCACTTGTCCCAGAGGGAGCTCATCACCCCAGAGGCTGACCATGTGGAGGCCGCCATCCTCGAAGAAGACGAGGGTCTGGAGATAGAGGAGCCAAGTGGCCTGGGGCTGATGGTGGGTGGCCCCGACCCTGACCTGCTCACCTGTGGCCAGTGTCAAATGAACTTCCCCTTGGGGGACATCCTGGTTTTTATAGAGCACAAAAGGAAGCAGTGTGGCGGCAGCTTGGGTGCCTGCTATGACAAGGCCCTGGACAAGGACAGCCCGCCACCCTCCTCACGCTCCGAGCTCAGGAAAGTGTCCGAGCCGGTGGAGATCGGGATCCAAGTCACCCCCGACGAAGATGACCACCTGCTCTCACCCACGAAAGGCATCTGTCCCAAGCAGGAGAACATTGCAGG
Ig BCL11B AY752980 GGAATTCCAAGGTGGATTATGGACTTCTTCTAACTCCCATTGATAGTGCTTCTTACCAGGTGAAGGGAAGGGCTACTTTTTCCTAAAGGAGAAAAAAGCTTTCAGACAAAGCTCGTACCAACCCCTGAACTGCAAATTTGCTCAAGTGACCGTGCATACTTATATTCCTAATTTAAATGATTATTTATGTCAAACGCTCATTGTGAAACTTGAAAATGTTGTATTACATTACATCAAATAAAGTTTACTTGTAGCAGACAGAAAGAGAGAAAGAGAAAGAAAGAAAGGAAAGAAAGGAAGGAAAGAAGGAAAGAAAGAAAGAAAGAAAGAAAGGGA
Ig BCL11B AY752981 GCGCCGTATTAAACAGAATTGTGTGAATTGAAGGTCACCTGGACCACTCTTGGAAAATGCTCCCGACCCCCATGGGGTTCCTTCCAGAGAATTTGTGTTCTCTGTACCTGAGATCAAATGTGTGTCTAAGCAATTCTGGCCCCTGGCTCCCACCACCCTACCCTCTCCACAAAATAATAGACATTAGGGGAGGTAAGGGAACAGAAGAGGTCTCTTTGCAGATATTATATTTTTAAAAAATGGTTCTATGTAATAAGCAGCAGCTAAGGAGACAGAAAGACAGTAGATGAAGAGAGTGCCAATATCTTCCATGGGGAAAAATGAATGAACTGAAAGAGAATATTATTTTTCTAGAATACAGAAAGC
Ig BCL3 S67305 cCAATGCCGTCTAGCTCAGAGTGAGAACAGAGAAGAGAAAGGAGCGGGC
Ig BCL6 10564588 CCAGGCCCCATGGAGAAAgGTTTTGAGCAAAATTTTG
Ig BCL6 10564588 CGGCAGAATGAGCAGGGGcAGCTCTGTAAAAAGGGAA
Ig BCL6 10564588 GGCTGAGACCCCCACCTCgGTTTTGAGCAAAATTTT
Ig BCL6 10637510 GCTGACCTAACCAGGGCTGGGCTCAGCTGgCTAGTGTTGCAATATTGAGTTTTAAAGCTC
Ig BCL6 10637510 GCTGAGCCGGGCTGATCTGGGCTGAGCAGgCGTCGGCTGTGTTTTTTCCCTCTTTTCTC
Ig BCL6 10637510 GGCTGGGCTGAGCTGAGGTGGGTTGGgCAGAACCAAAGCGATTTTTTAAAAAAATGAAAA
Ig BCL6 10637510 GTTGAGCTGAGCTGAGCTGAGCTGGGCTAaCCGTGATCTTCCTAATGAGAGCCGAGTGTT
Ig BCL6 10637510 TGAAGCTGAGTGGAGGTGGTGCAGGTCAGcGGCGCGGCGGCGGCGGCCCGGGGAGGGAGT
Ig BCL6 10637510 TGTGCTGCACTGAGCTGGGCTGAGGTGGgTTTTAAAGTAAAGTGAGTGTCAGTAGATGTG
Ig BCL7A X90000 GGCCAGCAGAGGGTTCCATGAGAAGGGCAGGACAGGGCCACGGACAGTCAGCTTCCATGTGACGCCCGGAGACAGAAGGTCTCGGGTGGACTGGGTTTTTGTGGGGTGAGGATGGACATTCTGCCATTGTGGTTTCCCCAAACCCAGGGAGGCGCAGAGGTACAGCCCTCAAGCTCCAACTACAGGCCTGGTCCCCGCGGGTCAGCGGCTGGAAGGCCTCCAGGCCCGCCCCGGGCCCGCGGGGTGGGAAGCCCCATCTCTCCATCTCCCTCCTCAGAGCGACTGCCGCTCTGGCAGNCTGTCAGGGTGCAGGAGCCTCTGTCCAGCCGGGAACCTGAGTAGGAGGCCCACCACGCCTCCTCGAGCAGAGAAAGGCGGCTTGCCTGTTTCCCAACCTCCAGGCCGGCGACAGAAGGGACCCAGGCACAGACACCAGTTCTTTCTTTGCACAGGGGCTGAGGCAAGGAGGGGAGCAACTCCGGGCTTCCCGCGGGGAATCCCACAGTAGAGGGGGCTGCGGGTTGTTTTCCAGCGTGTGTGTGTTGGCCTGCAGCTGTTTCTGCCATTTTTAAATGGCTCCAGTCGGGCACCGGGCACCCTGTGTACCAGGGGAGCTCCCGAGACACCGAC
Ig CCND1 X66970 GTGGAGGTGGGGTGTTTGGGAGGCTGCGTGCCAGTCAAGAAGAAAAAGGTTTGCATTCTCACATTGCCAGGATGATCGTGTCCTGGTGCCCTAGAACCAGGGCAGGGTGGCAGGCTTGGCGGATGTGGGAGGCCGCAGCTGTCCTGTGCGCTGTGGGAAGTTCAGCAGCATCCTGACCTC
Ig CCND3 AF364073 CCAGGAAGGGAGTGTGAGCCCATCCCACTGAGCAGTTGGCAAGGGTGAGCTGGGATGGAGAAGGGAAGGCATTCCAGGGCTCGGGGCTGAGCTCTCAGGCAGGGGCAGGTGTGGCTGCAGGGGTAATAATAATTATTATTATTTTAAGACAGGGTCTTGGTCTGCACTCAGGCTGTAGTGCCACGGTGCAATCATAGCTCACTGTAGCCT
Ig CCND3 AF388309 TCCCACTTTAGGTGGGGTGTGCCCCTGACCTCTGAGGAGGCTAAGCGCCCTGCCCTCAGCCAGGCCATCCCCTCTGCTCAGCCCCAGGGCCCCGCTCACCGCCCCTTCCCCTCACCTGCACCACGGGCTCTGGCTGACTCTGCCCAGGCCCTGAATGGGCCCCTCTGGCTGTGCTGCTCAGGCTATCCTTGAACTCCTGAGCTCAAGTGA
Ig CCND3 AF388310 ACTCTGCCCAGGCCCTGAATGGGCCCCTCTGGCTGCCCTCTGCTGCTACACTGTCCTGCACCACCTCCACTCAGCTTCATTGTGCTGGTGGCCCTGGCTCCTGGCAGCCCATCTTGCTCCTTCTGGGGCACCAGCCTCAGAGGCCTTCCTGCCCAGGGTCCGCTGGGACCAGCCGTGGGACCCTCCTGGGTTCATGCCATTCTCCTGCCTCAGCCTCCGGAATAGCTGGGACTACAGGTGCATGCCACCATGCCTGGCTAATTTTTTATATTTTTAGTAG
Ig CDKN2A 8631023 GGGGGCACTCATATTCCCTTCCCCCCTTATAATTACGAAAAATGCAAGGTATTTTCAGTAGGAAAGAGAAATGTGAGAAGTGTGAAGGAGACAGGACAGTATTTGAAGCTGGTCTTTGGATCACTGTg
Ig CDKN2A 9345058 GACAGGACAGTATTTGAAGCTGGTCTTTGGATCACTGTGCAACTCTGCTTCTAGAACa
Ig CDKN2A 9345058 GACAGGACAGTATTTGAAGCTGGTCTTTGGATCACTGTGCAACTc
Ig FCGR2B AF209720 ctcagagcatctttgtgtatgctttctgtgggcccagtctgccctgactcaacctgcctc
Ig FCRL4 11290337 GGCCTGACAGCAACTTTTCTTCTACTAGTTCATCTTAa
Ig FCRL4 11290337 aTCTTAACTTTATCCTGGTAACTGGCGAGACAACCTGTCTTAAGTAACTGAAGGGAAA
Ig FCRL4 15496980 AGGAAGAGAAACACCGTTCCATTCCATCCATCCCAGGGAAGCGGGGAAACACAGTGGCCAGA
Ig FOXP1 AY909541 ACCCATGTCAATGTGTCTGTTGTCATGGCGGAGGTGGACGGCACCTGCTACTGAGCCGCCCGCCTGTCCCCACCCCTGAATAAACTCCATGCTCCCCCAAGCTGCTCAAGTTAAGTTAAAAAGCAAACAGAATTTCAACATGATGAAACCCCATCTCTACTAAAAATACAAAAATTAGCTGGATGTGGTGGCACACACCTGTAAT
Ig IL3 2114933 TTGtACCGCCATGTTATTGGGGGGGATCAAGACCTCTCAATACAACTGTCTCCTGCCAAT
Ig KDSR 8417785 TGGTATCAAGGAGTCATTGAATGTTTTCATGCAATGTATAGTTGCCg
Ig LHX4 12118377 ATGTGTGGTTTCCTTTGTGGCCAAGACAGA
Ig LHX4 AF416729 TAGAGAATTGAAATAGGGCCAGAATACAATGCCGCATCAGATTAACCCCTCAAATCTCAGTGGCATAACAAAGTACAGTGTTTGGCAGGTGGCTCTAACATTTTATATCTAGAATGTGTGGTTTCCTTTGTGGCCAAGAC
Ig MUC1 10753849 cATTGGAAGAATCCGAGATTAGTGACTAAGAAGAGAAAGGATGTT
Ig MUC1 10779441 gGAAGAATCCGAGATTAGTGACTAAGAAGAG
Ig MYC 17541401 CTGGGCTGAGCTGGGCTGAAATGGGCAGAATAGCCTCCCC
Ig MYC 17541401 GGGTCCTTCAGTGGTTATTACGCCAAGCCTCTGAGAAGCC
Ig MYC 17541401 GTGCAGCCTCTGGGTTCACCGTGCCCGCCCGCTGCTATGG
Ig MYC AJ586971 TGCTTACCTGGTTTTCCACTACCCGAAAAAAATCCAGCGTCTAAGCAGCTGCAAGGAGAGCCTTTCAGAGAAGCGGGTCCTGGGCTGAGCTAGGCTGAGCTGAGCTGGGNNNTGGTTGACATGGACTGAGCTGTGTTGAGCTGGGCTAGG
Ig MYC AJ586972 ATTTAGGCATTCGACTCATCTCAGCATTAAAGTGATAAAAAAATAAATTAAAAGGCAAGTGGACTTCGGTGCTTACCTGGTTTTCCACTACCCGAAAAAAATCCAGCGTCTAAGCAGCTGAGATGGGCTGGGCTGGGCTGGGCTGAGCTGGGCTGAGCTGAGCTGGACTGAGCTGGGCTGGGCTGGGCTAGGCTGGGCTGGGCTGGGCTGGGCTGGGCTGGGCTAGGCTGGGCTGGGCTGGGCTAGATTG
Ig MYC AJ586974 ACAGGCGGGCGGGACGCGCCGCAGTGTCCGTCTCCGGCTGTCAGAAATGCGGTGAGCCGAAATTTAAATGCCCTCCCGGAGACGGGGACAAGTCAGCGGCTGCGGAGCGATCTGGCTCACACAGGCGATATGCGGTCTAAATACCTCTCCCAGGCCAACCCTACACCTGCAGGCCCTCCCCTCCACTGCCAAAGACCCTCAGTTTCTCCTGCCTGTGCCCACCCCCGTGCTCCTCCTGCCCACAGCTCGA
Ig MYC AJ586977 CCCCCGGTCCAACACCTCCCTTTTGCCAGCTTTTCTTCTTTCTCTCGCCGGCTGGAGTTTGGGCTGGACTGGGCGGGACTGAGCTGGACTGGCCTGGGCTGAGCTGGGCTGGGCTGGACTGAGCTGGACTGGCCTGGGCTGGGCTGGGCGGGATGGGCTGAGGTGGCTGCTAATGTGGGAAAGAGGCCGTGGGTTGAGTG
Ig MYC AJ586978 CTGCGCCTACCCAACACCACGTCCTAACACCTCTAGAGACCCAGGTTTTAAATTGTATTATTGCATTTTAAAAAGCCCAGTGAGCTGAACTGGGCTGAACGGGCTGAGGCGAGCAGGGCCGAGCTGAGCAGAGCTAAGCCGAGGCTGGGCTGGGCTAACCTGGGCTGGGCTGAGCTGACCTGGGTTGGGCAAGGCTGGGC
Ig MYC AJ601396 CCCGAAAAAAATCCAGCGTCTAAGCAGCTGCAAGGAGAGCCTTTCAGAGAAGCGGGTCCTGGCAGCGCAGGGGAAGTGTCCCCAAATGGGCAGCCGTAACCTGGACTGGGGCTGAGCTAACCTGGGCAGA
Ig MYC AJ601397 CCAGGACGCCCGCAGCGCAGCTCTGCTCGCCCGGCTCTTCCACCCTAGCCGGCCGCCCGCTCGCTCCCTCTGCCTCTCGCTGGAATTACTACAGCGAGTTAGATAAAGCCCCGAAAACCGGCTTTTATACTCAGCGCCAGCCCCCAGGAAAGGGGCTGGAGTGGATTGGGGAAATCACTCATAGTGGAAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAA
Ig MYC AJ601398 CCAAGCCTCTGAGAAGCCCTGCCCTTCTCGAGGCAGGAGGGGAGCCAGGGACGGCCGGGGCTATGCTGGGCTGATCTGGGCTGATCTAAGCTGGGCTGGGCTGGGCTGATCGGGGCTGAGCGGGGCTGATCTGAACTATGCTGGGCTGAA
Ig MYC AJ601399 CCTCTCGCTGGAATTACTACAGCGAGTTAGATAAAGCCCCGAAAACCGGCTTTTATACTCAGCGCGATCCCTCCCTCCGTTCTTTTTCCCGCCAAGGCTCTGAGAAGCCCTGCCCTTCTGAGTTGAGCTGAGCTGGGCTAAATTGCACCA
Ig MYC AJ601400 AAAAGTGTCAATAGCGCAGGAATGGGAGAAAAGACACCCTATTTAGGCATTCGACTCATCTCAGCATTAAAGTGATAAAAAAATAAATTAAAAGGCAAGTGGACTTCGGAGTTGTACTGAGCTGGCCTGG
Ig MYC AJ601402 TCCCTCTGCCTTCTCCTCTCCCATCTTGACAAGTCACTTTACCCCGATCCAGTTCTGGATTACCCCCCACCCCAGCCCCAGTTACCATAACTACTCTGAGAAAAGTGTCAATAGCGCAGGACCATTGTCTGGGTCACTCCCATTTAACTTTCCCTAAAGCCCATTTGAAGGAGAGGTCGCACGAGCTGCTCCACAACCTCTGAATGGGGATGGCATGGGTAATGATGCTTGAGAACATACCAAGCCCCAC
Ig MYC AJ601404 GGGGCTTTCTGCCCACCGCAAAGCAACCCCCAGCCCCCCAAAACCCAGAGAGCAATTAACACAATAAAGCAGGAATGTCCGACCGGCCGGGAGTCAGCGTAAATATATTCATAAGTTGGACTGGGCTGGGCTGGGTTGGGCTGAACTGGGCTGGGCTGAGTTGGGCTGAGCTGGGCTGAGCTGAGTTGGGCTGAGCTGGGCTGAGCTGAGTTGGGCTGGGCTGAGCTGGGCTAAGCTGGACCTGGCTGGG
Ig MYC AJ628702 TTTCCAAGTCAACGATTCCAGGAGAATCGGACACATCCTCGCCTCCCTTTTCCCCTGCCTGCGCCTACCCAACACCACGTCCTAACACCTCTAGAGACCCAGGTTTTAAATTGTATTATTGCTTTTTAAAAAGCCAAATGCCAACTTCCTGGCTGGGGTGAACTAGGCTGGGCTGCGTTGAGCTGGGCTGGGCTGGGCTGGGCTGAGCTGGGCTGGGCTGAGCTGAGCTGGGCTGACCTGGGCTGGGCTG
Ig MYC AJ628704 GTCCCACCCCAGTACCGCCCCCGTCCAACACTCCTTTTGCCAGCTTTTCGACTGAGCTGTGTTGAGCTGGGCTAGGCTAAGCTAGGCTGGGCGGAGCTGAGCTGGGTTGGGCTGAGCTGAACTGGGCTGGACTGGGCTGGACTGGGCTGGGCTGGGCTGGGCTGGGCTGAGCTGAGCTGAGCTGTACTGAGCTGGCCTGGGCCAGGCTGAGCTGGGCTGGGCTGAGCTGTACTAAGCTGGCCTGGGCTGG
Ig MYC AJ628705 AGAAGCGGGTCCTGGCAGCGGCGGGGAAGTGTCCCCAAATGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGCTCGGGTGTTGTAAGTTCCAGTGCAAAGTGCCCGCCCGCTACTATGGGCAGGTGAGTAGGGGCAGGTGGGGGGCAGGAGGAGCAGGGGGCAGGCACTGGAGCTCAGGGGACCAGGGCAGAGCAGCCGCAGGTGAGCAGGGGCAGGTGGGGGGCAGGAGGAGCAGGGGGC
Ig MYC AJ628706 GATCAGGGCGGGTTGGAATCGCCGCGGGGACAGGCGGGCGGGACGCGCCGCAGTGTCCGTCTCCGGCTGTCAGAAATGCGGTGAACTGGGCTGAGCTGAGTTGGGCTGAGCTGGGCTGAGCTGAGTTGGGCTGGGCTGAGCTGGGCTAAGGTGGACCTGGCTGGGGTGACCTAGGCTGGGCTGCGCTGAGGTGGGCTGGGCTGGGCTGGGCTGAGCTGGGCTGGGCTGAGCTGAGCTGGGCTGACCTGGG
Ig MYC AJ628707 ATTGTATTATTGCTTTTTAAAAAGCCAAATGCCAACTTCTTAAAAGGATCAGGGCGGGTTGGAATCGCCGCGGGGACAGGCGGGCGGGACGCGCCGCAGTGTCCGTCTCCGGCTGTCAGAAATGCGGTGAGCTGAGATGAGCTGAGCTGGGCTAAGTTGCACCAGGTGACCTGAGCTGAGCTGGGCTTGGCTGCACTAAGTGGCTGGGCTGAGCGGGTCTGAGCGGGGCTGAGCTGAACTAGGCTGGGCC
Ig MYC AJ628708 GGCGGGGAAGTGTCCCCAAATGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGACCTGGCTGGGGTGACCTAGGCTGGGCTGCGCTGAGCTGGGCTGGGCTGGGCTGGGCTGAGCTGGGCTGGGCTGAGCTGAGCTGGGCTGACCTGGGCTGGGCTGACCTGGGCTGGGCTAAGCTGGACTGATCTGGGCTAGGCTGGGCTGGGCTGACCTAAGCTGAGCCAGACTGGGCTGAGCTGGGTG
Ig MYC AJ628710 CCCCCCACCCCAGCCCCAGTTACCATAACTACTCTGAGAAAAGTGTCAATAGCGCACTGGGGCCAGGGAACCCTGGTCACCGCTCTTAGGGA
Ig MYC AJ628711 ACCGGCTTTTATACTCAGCGCGATCCCTCCCTCCGTTCTTTTTCCCGCCAAGCCTCTGAGAAGCCCTGCCCTTCTCGAGGCAGGAGGGGAGCCAGGGACGGCCGGGGCCCGGCAGTGGCTTGAGCAGAGCTGGGGGCTGAGCTGGGCTGGGCTGGGCTGAGTTAAGCTGGGCTGACCTGGGCTGAGTTAAGCTGGGCTGACCTGGGCTGAGCTAAGCTGGGTTGAGCCGATCCGGGCTNNNCTGGGCTGG
Ig MYC AJ630033 TATTTAGGCATTCGACTCATCTCACCATTAAAGTGATAAAAAAATAAATTAAAAGGCAAGTGGACTTCGGTGCTGACCTACGCTGGGCTGGGCTGGGCTGAGCCGAGCTGAACTGGGCTGAGCAGGCTGTGTCGGGCTGAGCCAAGCTGG
Ig MYC AJ630038 TCCCTTTTCCCCTGCCTGCGCCTACCCAACACCACGTCCTAACACCTCTAGAGACCCAGGTTTACGCTGGGCTGGGCTGGGCTGAGCCGAGCTGAACTGGGCTGAGCAGGCTGTGTCGGGCTGAGCCAAGCTGGGCCGAGCTCAGCAGAGCTGAGTCGAGCTGAGTTTAGTTGGGCTGAGCTAACCAGGGCTGGGCTGAGCTGGGCTGAGTTGAGCTGAGCTGAACTGGGCTGAACGGGCTGAGGCGAGC
Ig MYC AJ630041 ATGCAAGGGGCTTTCTGCCCACCGCAAAGCAACCCCCAGCCCCCCAAAACCCAGAGAGCAATTGACCTGGGCTGAGCTGAGCTGAATTGGGTTGACCTGGGCTGAGCTGGGTTCGGCTGGGCTAGGCTGACCTGGGCTGGGCTGAGCTGAACTAGGCTTGGATGAGCTGAGCTGGGCTGGGTTGCACTGCGCTGGGCTGGGTTGGACTGGTCTGGGCTGACCTGAGCTGTACTGAGCTGGTCTGACCTGT
Ig MYC AJ630604 TTCCCTCTGCCTTCTCCTCTCCCATCTTGACAAGTCACTTTACCCCGATCCAGTTCTGGATTACCCCCCACCCCAGCCCCACCTGCAGGGAGGCTCGGCACTCCCTGTAAAGACGAGGGATCCAGGCAGCAACATCATGGGAGAATGCAGGGCTCCCAGACACCCCAGCCCTCTCGCAGGCCTCTCCTGGGAAGAGACCTGCAGCCACCACTGAACAGCCACGGAGCCCGCTGGATAGTAACTGAGTCAG
Ig MYC AJ630607 CCCCTCCATAAATACAGGGGGGGTGTCAAATAATAATAGGGGCACCTCCCTTCGCACTCAATACGTAGATGCTGAGCTGGCCTGGGCTGGGTTGACCTGGGCTGAGCTGGACTAAGCTGGGCTGACCTGGGCTGGGATGGGATGGGCTAGGATGACTTGGGCTGGACTGGGCGGGACTGAGCTGGACTGGCCTGGGCTGAGCTGGGCTGGGCTGGACTGACCTGGACTGGCCTGGGCTGGGCTGGGCGGG
Ig MYC AJ630610 GCAGCGGCGGGGAAGTGTCCCCAAATGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGCTCGGGTGTTGTAAGTTGGGAAGGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCT
Ig MYC AJ630613 TTCCCCTGCCTGCGCCTACCCAACACCACGTCCTAACACCTCTAGAGACCCAGGTTTTAAATTGTATTATGAGCTGAGCTGGGTTTGTTTGACATGGACTGAGCTGTGTTGAGCTGGGCTAGGCTAACCTAGGCTGGGCGGAGCTGAGCTGGGTTGGGCTGAGCTGAACTGGGCTGGACTGGGCTGGACTGGGCTGGGCTGGGCTGGGCTGGGCTGAGCTGAGCTGAGCTGTACTGAGCTGGCCTGGGCC
Ig MYC AJ630614 GCAATTAACACAATAAAGCAGCAATGTCCGACCGGCCGGGAGTCAGCGTGAATATATTCATAAGGCAGAAATGTCGAAAGGGTAGTCTTAAAAACCATTCCCGTTTTCCCTCTGCCTTCTCCTCTCCCATCTTGACAAGCTGAGCTAGACTTGCCTGAGCTGGGCTGGGCTGGGCTGGACTGACCTGGGCTGGGCTAAACTGGACTGATCTGGACTAGGCTGGGCCGGGCTGACGTAAGCTGAGCCAGAC
Ig MYC AJ630616 ATGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGCTCGGGTGTTGTAAGTTCCAGTGGGTGACTTAGCAGCCGTCTGCTTGCAGTTGGACTTCCCAGGCCGACAGTGGTCTGGCTTCTGAGGGGTCAGGCCAGAATGTGGGGTACGTGGGAGGCCAGCAGAGGGTTCCATGAGAAGGGCAGGACAGGGCCACGGACAGTCAGCTTCCATGTGACGCCCGGAGACAGAAGGTCTCTGGGTGG
Ig MYC AJ630618 TGGGCAGAATAGCCTCCCCGCGTCGGGAGAGTCGCGTCCTTGCTCGGGTGTTGTAACTTTATCACAAAACAAACTGACAATAGGGAAGCACAATTTCCCAATGCTTTCAATATCACAGATCTCCCCGAGGACAGTCTGACATGCTCTGAGCCCCACTATCTCCAAAGGCCTCTCACCCCAGGGCTTACTATATAGTAGGTGATATGCAAATAGAGCCCTCCGTCTGCTGATGAAAACCAGCCCAGCCCTG
Ig MYC AJ630620 AAAAGTGTCAATAGCGCAGGAATGGGAGAAAAGACACCCTATTTAGGCATTCGACTCATCTCAGTTGGGCTGGGCCGGGCTGGGCCGGGATGGGATGGGCTGGGCTGGGCTGGACTGGGCTGGGACGGGCTGGGCTGGGCTGGGCTGGGACGAGCTGGGCTGGCCTGGGTTGAGTTGAGCTGAGCTGAGCTGAGCTGGGCTGGCCTGAGCTGGGCTGGGCTAGGCTGGGCTGGGCTGGGCTGGGCTTGGA
Ig MYC AJ630621 GCCGCCCGCTCGCTCCCTCTGCCTCTCGCTGGAAGGCTGGGACGAGCTGGGCTGGCCTGGGTTGACCTGAGGTGAGCTGAGCTGAGCTGGGCTGGCCTGAGCTGGGCTGGGCTAGGCTGGGCTGGGCTGGGCTGGGCTTGGACGAGCTGGGCTGCCCTGGGTTGAGCTGAGCTGAGCTGAGCTGGGCTGGGGTGAGCTGGGCTGGGCTGGGTTGGGCTGAGCTAGACTGGGCTGGGCTGGGCTGGGCTGA
Ig MYC AJ630622 GGCTGCGGAGCGATCTGGCTCACACAGGCGATATGCGGTCCCTACTCCAAGGAGCTCAGGATGCAAGGGGCTTTCTGCCCACCGCAAAGCAACCCCCAGCCCCCCAAAACCCAGAGATCTGGGCTAGGCTGGGCTGGGCTGACCTAAGCTGAGCCAGACTGGGCTGAGCTGGGTGACCTTAGGTGGATTGAACTGGACTG
Ig MYC AJ630625 TGCCAACTTCTTAAAAGGATCAGGGCGGGTTGGAATCGCCGCGGGGACAGGCGGGCGGGACGCAAATGAACAGCCTGAGAGCCGAGGNACACGGCTGTGTGTTATTGNGCGAGGGGGGGCGTGGCTGATGACAGCAACTGCCGTACATACCTAGGAAGCGCGATTAGTAGNTTCCCTACGGTATGGACGTCTGGNGCCAAGGGACCACGGTAACCGTNTCCTCAGTAAGATTGGCCACTCTAAGGGCTTT
Ig MYC AJ630627 CCGGGGCCCCTCCGCTGCGGCTGTTCCCACTCGCGCCCTAGCCGCTCTCCTACCCCCGCCGGCACCGCAGCCCCTCCCAACCTTCCCTCTCCACCNNNCCCGTCCCCACCCCCACTGAGCTGGTCTGACCTGTGCTGAGCTGGGCTGGGCTAGGCTGACCTGGACTGACCTGTGTTGGGCTGGGCTGGGCTAAGCTGGGCTAGGCTGGGCTGAGCTGGACGGAGCTGACCTGGATGAGCTTAAGTGGACT
Ig MYC M30444 TCCAGATGGCCAGGCTCATTCTGGGCCTTTTTCCCCACAATCCCCAGGCCCAGGGCGGCTCCCAGGGCCCCCATTCCCCCACCAGAAGCTGTTGCTCAGCCACTATCATCAGGCTGGGCGCAGCTCCTTGGAGTAGGGACCGCATATCGCCTGTGTGAGCCAGATCGCTCCGCAGCCGCTGACTTGTCCCGTCTCCGGGAGGGCATTTAAATTTCGGCTCACCGCATTTCTGACAGCCGGAGACGGACACTGCGGCCGGTCCCAGCCCGCCTGTCCCCGCGGCGATTCCAACCCGCCCTGATCCTTTTAAGAAGTTGGCATTTGGCTTTTTAAAAAGCAATAATACAATTTAAAACCTGGGTCTCTAGA
Ig MYC X00252 AGCTCGGCCCAGCTTGGCTCAGCCCGACACAGCCTGCTCAGCCCAGTTCAGCTCGGCTCAGCCCAGCCCAGCCCAGCGTAGCTCAGCTCCCGGCCGGTCGGATATTCCTGCTTTATTGTGTTAATTGCTCTCTGGGTTTTGGGGGGCTGGGGGTTGCTTGCGGTGGGCAGAAAGCCCCTTGCATCCTGAGCT
Ig MYC X63555 TCCTTGCAGCTG
Ig PAFAH1B2 8108133 tGGTTTTGGCCTCCGACCAGACGCGAGGGGAGAGAAGAGTGAGAAGT
Ig WHSC1 15496980 tTGTGTGGGCTGTTCTTGGGTGTGGACTACCTGCCACCTGTCCTTCCTCTTTGAGCATAATTC
Ig WWOX AF055380 GCAAAACTGACCTAAGCCGACCTAGACTAAACAAGGCTGTCTGGGCAGGGCCGAAGCCTCTTCCTGGCTC
Ig WWOX AF055382 CAGGCTGGGCTGACCTGGACCAGGCTGGGCCAGGTTGAGCTGGGCTAAGCCGAGCTGAGCGGGTCATGCTCTCCTTTCTCTTTGACTGGAAAGCCCTTCAGGGTCAGTACCTCATTTCTGGTGTGAATATTCACTTTCTC
Ig WWOX AF055383 GAATGGAAACCGTCCTCCTCCCCTACACCATGGCGCAGCGTCAGCTTCCTGCTTACAAACAACAATCTGGGCTGGGCTGGGCTGGGCTGAGCTGACCTGGGCTGGGAGATGAGCTGAGCTGAGTTAAGCTGAGCTGAGCT
MYC Ig 15496980 aGACGCTGGATTTTTTCGGGTAGTGGAAAACCAGGTAAGCACCGAAGTCCACTTGCCTTTT
MYC Ig 17541401 aaaaggcaagtggacttcggAgttgtactgagctggcctg
MYC Ig 17541401 cccctattcgctccggatctAagttgcaccaggtgagctg
MYC Ig 17541401 ccgcgagcagcacagctcggCcgcatgtgagcaggggcag
MYC Ig 17541401 gctgcaaggagagcctttcaGctgagctggactgggctag
MYC Ig 17541401 ggccgcgagcagcacagctcAagatcatccgcaggtgagc
MYC Ig 17541401 ggttttaaattgtattattgGcttttgagcaggggcaggt

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)