TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'HMGA2'. The HGNC name for this gene is 'HMGA2'.

15 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
HMGA2 CCNB1IP1 11223542 CCCTCTAAAGCAGCTCAAAAgGTACATCAGGAACGTCTCTAT
HMGA2 COG5 20804914 cagaagaagcctgctcagAggggagactatatttcc
HMGA2 COX6C 10679920 AGAGGCAGACCTAGGAAATGgAATTTCTTCAGGTTGAATTACCTAGAAGTTTGTCACTGA
HMGA2 FHIT 8988031 TTTCACAGGAATGACAGCATCTATGAGGAgCCACAACAAGTTGTTCAGAAGAAGCCTGCT
HMGA2 LPP AF393503 CACCCAAATACCTGGAAACGGGAACCAGGGTACACTCCTCCTGGAGCAGGGAACCAGAACCCTCCTGGGATGTATCCAGTCACTGGTCCCAAGAAGACCTATATCACAGATCCTGTTTCAGCCCCCTGTGCGCCACCATTGCAGCCAAAGGAACAGATCCTGGGAGCCGACCTCGGTGCCTCAAAACCAAGATCCCAGCTGAAGCATTGTCTTGGAAGGAAGCACCATAAATTGTGACAGTGGAGGCCTAATGGAATGCAGCATCGCACGCGAGCCCCATGGATGGGAAACAGACCTGATTAGGTGCCATCAAAACAACACAACTGACCATTGGAAACTCTGCTGAGGTCTCAGGTGCTGAGGAGCAGGAGAGAAGAAGAGAAAGAAGTCCTGTGGGGCTCACACAGCCGGCCAGCCTCTCATCTCAAAGACAGAAACGAGGTTTGGCTTCATTCTTTTCTGCCCACTGATTGCTTTATTTCAAATTACCCTAACTACTTAGCATGGCAAATTAAGTTAAAACCCCCAAGAGTCTGCCGAAGAGGACTAGAATCTGATTAAAAGGAATAGTCCCGTCACAAGCTAGGGAGGAAATGGAAATTACTCTGAGTGCAGTGCTATTAAATAATT
HMGA2 NFIB 9484777 agttgttcagaagaagcctgctcagTcctggtacctgggctagcttggttcctttccaag
HMGA2 NFIB 9484777 ccaagaggcagacctaggaaatggTcctggtacctgggctagcttggttcctttccaagtg
HMGA2 RAD51B AF533653 AAACAAATATTGCCAACTCTTCTATTTATGGATATCACACATATCAGCAGGAGTAATAAATTTACTCACAGCACTTGTTTTCAGGACAACACTTAGCAACAGGATTGTCACAAAAGATTCAACAGTCATCTCCTCAGGTAACCAATTGTTACACAAACCATATGTAGAAAATGCTCACTGGCTTCATTTATAGAAAAAAAAAAAGATAAC
HMGA2 RAD51B AY138858 AGAAGCCACTGGAGAAAAACGGCCAAGAGGCAGACCTAGGAAATGGGTTATCTTGACGAATCAGATTACAACCCATCTGAGTGGAGCCCTGGCTTCTCAGGCAGACCTGGTGTCTCCAGCTGATGATTTGCCCCTGTCTGAAGGCACTTCTGGATCCAGCTGTGTGATAGCCGCACTAGGAAATACCTGGAGTCACAGTGTGAATACCCGGCTGATCCT
HMGA2 RAD51B AY387666 GTTGAGAGGGCAATGGCAAGCAATCTTGGTACATGTCAGCTGCATCTCAGGATGTTTGGCTGAGAAGTGTGATGAGTGCCTTCCCTCCATTTGTGCAAAAGAAGCCTCTTTGAATTCTGGAGTGGAATGAAGAAAGTCCTTTCACAGCCACAGGATAAAAGTGATGGTGATGATATTGAAAATAAAACATGGG
HMGA2 WIF1 18828159 actgcagtgaccacttattctGcagaatacttctatgaattcctgtcctt
HMGA2 WIF1 18828159 gaggcagacctaggaaatggCtgtctgcgagcctggctgtggtgcacatg
HMGA2 WIF1 18828159 gaggcagacctaggaaatggGcagaatacttctatgaattcctgtccttg
HMGA2 WIF1 18828159 gaggcagacctaggaaatggGgtacgaagccagcctcatacatgccctga
HMGA2 WIF1 18828159 gaggcagacctaggaaatggTtgttcaagttggtttcccatgtcttggaa

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)