TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'GAS7'. The HGNC name for this gene is 'GAS7'.

5 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
KMT2A GAS7 16956839 cagagtggactttaagAagcctggaatggtcc
KMT2A GAS7 16956839 tagtgggcatgtagagAagcctggaatggtcc
KMT2A GAS7 AF231994 AGGCCTCAGTTTGTCCATCTGTAAAATGATGAGATGTGATCAGATGATTACTAAGGTGCCTTCTGTCTCTAATTTTTGTGTTAGCGTTGCATTGGTTGAGAAAGTCATTTTGTCTCTGTTTTCTTAAAGATAAAGCCCCCCCACCCCACCAACTGTCTTGCCATTTGAAAGATAATACAATAAACCCTACCTGATAAATAGTACTCATTTTAGGGGCAGTTCTTAAATTCCTGGCAGATACCTCTTTGGCTTATTACTTACCACATAAGATATGTATTCAAAGGTGGTAAAGAAAATCCACGTCGGG
KMT2A GAS7 AF231997 AATGCAGGCACTTTGAACATCCTCAGCACCCTCTCCAATGGCAATAGTTCTAAGCAAAAAATTCCAGCAGATGGAGTCCACAGGATCAGAGTGGACTTTAAGAAGCCTGGAATGGTCCCCCCTCCGCCGGGAGAAGAAAGCCAGACGGTCATCCTTCCACCTGGCTGGCAGAGCTACCTGTCGCCTCAGGGCCGGCGGTACTATGTCAAC
KMT2A GAS7 AF232002 TGAGGAAGGAAAAAGTAGCACAATTTTAAATAGGAAGCAGTAGTTTGTCATTTATAAGGGACATTGGACTTGTTTAAATAATTTTAGTAAGGTGATACTCATGTACTAGCTGATAATAGAAAATAAGCTTAGAATTTTTA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)