TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'FUS'. The HGNC name for this gene is 'FUS'.

24 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
FUS ATF1 AJ295163 TATGGACAGCAGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGTTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACAGGGACTTCAGACATTAACCAT
FUS CREB3L1 15640831 ttgagtctgtggctgattacttcaagcagattgGctctctgcccccctccagccctgtcaggcccatg
FUS CREB3L1 17721195 TATGGACAGCAGGACCGTGGAGGCCGCGcCACGGCCATCTCCACCTCCCCACTCCTCACTGCCCCTCACAAA
FUS CREB3L2 17721195 AGGTGGCCGTGGAGGCAGAGGTGGCATGcCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAG
FUS CREB3L2 17721195 GCAGAGGTGGCATGGGCGGAAGTGgCAGCCTGAGTCCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGA
FUS CREB3L2 17721195 GTACAACAGCAGCAGTGGTGGTGGAGGTGaAACTGCAGGGATCAGGCCCTCTGGTCCTGACAGAGGAGGAGAA
FUS CREB3L2 17721195 GTACAACAGCAGCAGTGGTGGTGGAGGTGtggtccactggggctgcaaaaaaggaagcacGAGTCCCAACCCACGCCTGCA
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGatgtctTGACTCAGAGGGCAGCCTGAGTCCCAACCCACGCCTGCACC
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGcCTGAGTCCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGA
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGcttccaggaattggctactCCACGCCTGCACCCCTTCAGCCTGCCTCAGAC
FUS CREB3L2 17721195 GTGGTGGCTATGAACCCAGAGGTCGTGGAaACCCACGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAGCCC
FUS CREB3L2 AJ549094 GTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGAGGCCGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAGCCCCTCCAGAGCTGCACCCCGGGCCCCCTCCGCCCTCTCCAGCTCCCCTCTCCTCACGGCTCCTCATAAACTGCAGGGATCAGGCCCTC
FUS CREB3L2 AJ549096 ACCGCCATGGAGGTGCTGGAGAGCGGGGAGCAGGGCGTGCTGCAGTGGGACCGCAAGCTGAGCGAGCTGTCAGAGCCCGGGGACGGCGAGGCCCTCATGTACCACACGGCCCTCGGGACCAAGGATCACGTCATGACTCCGACAAACAAGAAAACGGGACAGCCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGA
FUS CREB3L2 AJ549097 TAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTCACAGCCTCACTCCAAACCCTTTCCTGGGTCGCCCTTCAGCCTGCCTCAGACCCACAGCCCCTCCAGAGCTG
FUS DDIT3 AJ301611 TGGTGACTGGAAGTGTCCTAATCCCACCTGTGAGAATATGAACTTCTCTTGGAGGAATGAATGCAACCAGTGTAAGGCCCCTAAACCAGATGGCCCAGGAGGGGGACCAGGTGGCTCTCACATGGGGGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCC
FUS DDIT3 AJ301612 CAGGCTATGGCCAGAGCAGCTATTCTTCTTATGGCCAGAGCCAGAACATGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCC
FUS DDIT3 AJ301613 ATGATCGAGGCGGCTACCGGGGCCGCGGCGGGGACCGTGGAGGCTTCCGAGGGGGCCGGGGTGGTGGGGACAGAGGTGGCTTTGGCCCTGGCAAGATGGATTCCAGACCTTCTGCAGTCAGAAAGTTTCTGCAGTAATTTAGAGATGGTAGTGAATTGATCTAGATTGGAAACAATGGAATTAGAAGTGTTTAGATTCTTCTAAGCAAAG
FUS DDIT3 AJ301614 ATAGGAAGTCATTGGAGGGTTTGAGCAGAGGAATGACCTGTTTTAAAAGGCTCACTCAGGCTGCTGTATGGTGAATAGAGTTGCGAACAGAGGCCATAGGATAACAGGGTTTTGTTGAGAAAGTGGTTTCATTTTGAGGGCTAGGTGGAAAGACCTGAGGTTGTAACCAGTAGTGGAGAGGGAAGGAAAATTAACTCAGGGGGAGTGAAT
FUS DDIT3 Y10002 GTGTGGGAGACAACTCCGAATGTTTAATTCTGGAAGAGGGATGTAACATTGCCCTGAGGATGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGACCAGAGGTGGGTGGATCACCCTG
FUS DDIT3 Y10003 TGAGTGTGTGGGAGACAACTCCGAATGTTTAATTCTGGAAGAGGGATGTAACATTGCCCTGAGGATTCGAGATGGTAGTGAATTGATCTAGATTGGAAACAATGGAATTAGAAGTGTT
FUS DDIT3 Y10004 TGGTTTCTAAAGATGAAATTAAGAATTGTTCCACAAGGGTTAAGTGTCTGGTGGTAAAGTTGGGCTCGGAGGCCTACAGTAACCCAAATATAAGTGCCACGGAGAAAGCTAAAGCAGAGA
FUS ERG 19737655 gtggaggtggagAtttaccatatg
FUS ERG Y10001 ATCCTTTTGATCGTTGTGTCCAAGGCTTGTGTGTGTGTGAGTGTGTGGGAGACAACTCCGAACAGTCCTGAGCCCTATGTCTTTATGGCTACTGGGTAAAATAGTCAAGTGAGAAATTAG
FUS FEV 17620387 gcagctattgactggtttgatgAtcccgtcggagacggtctctt

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)