TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'FOXP1'. The HGNC name for this gene is 'FOXP1'.

4 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
FOXP1 ABL1 21391972 acacctctcaatgcagctttacagCtctacgtctcctccgagagccgctgtggagagttacgtcgaaatgtc
Ig FOXP1 AY909541 ACCCATGTCAATGTGTCTGTTGTCATGGCGGAGGTGGACGGCACCTGCTACTGAGCCGCCCGCCTGTCCCCACCCCTGAATAAACTCCATGCTCCCCCAAGCTGCTCAAGTTAAGTTAAAAAGCAAACAGAATTTCAACATGATGAAACCCCATCTCTACTAAAAATACAAAAATTAGCTGGATGTGGTGGCACACACCTGTAAT
PAX5 FOXP1 17344859 gagcccatcaagcccgagcagGcacttcaggtggcaagacag
PAX5 FOXP1 18697940 CAAGAGAGACGAAGtTTGTCCCATGAG

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)