TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'FLI1'. The HGNC name for this gene is 'FLI1'.

50 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
EWS FLI1 23441188 AAATCCAATAGCATTTTGCAGAGTatGGAAGGATTGTCCTGGGGCCTGAA
EWS FLI1 23441188 AAGCTGCTTTTGGAGACATCTTAGgaAGGTCCATTCTGAGCACATTGCAT
EWS FLI1 23441188 AATAAGCCTGGTGGTAAGTTTTTGatAACTCATGGAGGGTTTAAACAATA
EWS FLI1 23441188 ACAAGGATTAAATGACAGTGTGACtaAGGAAAGTTGATAGAGCAGAATCG
EWS FLI1 23441188 ACTCTTTGCCATTGTTTGCTTTTGggGCTGAAGGGCATGGTTGTGTTTCA
EWS FLI1 23441188 AGACATAAGAAATTAATTTCTGCAttGGGCACTGGTCTCCTATTTCAGCA
EWS FLI1 23441188 AGACTTTGCTAGTAGAGGGGGCCCcCACAACTGTACGTTCGTACATCTCA
EWS FLI1 23441188 ATCTTCAGAATTTAGGATCATTGCtgTATGTCTATGAGAGGGTCATGTCC
EWS FLI1 23441188 ATGCCTTGGCAAAAAAGAAAAGAGagGCAAATCATGGGAATTGTTGGGAT
EWS FLI1 23441188 ATGGCATTCCAGCTAACATCTTGGaAATACTGTGAGGTAATCTCCTGTTA
EWS FLI1 23441188 ATTATCTTCAGAATTTAGGATCATtaGCAAAATTTTACAAAATACATGAC
EWS FLI1 23441188 CAAGGCAGGAGGATCACTTGAGACctCCATGCACGCTCAGGCTTCTTCTC
EWS FLI1 23441188 CACGGGGATTTCTCAACAACTCAAaTGTCCAGAAACAGCTTTCGCCTTCC
EWS FLI1 23441188 CAGTCATGAGCCACTGCGCCCAGCccTAAAAAGCATTTTCATATGCATGG
EWS FLI1 23441188 CCTAATTTTGTTTCATCCACAAGAaTTTAAACTTTATCAGTCAAAATCCA
EWS FLI1 23441188 CCTCCCTATCAGTCATTAATGTAAacTATTCCAATTTGAAAATAGATAGA
EWS FLI1 23441188 CTAATGACCCTAAGTTGTTAACTAaTGGCCACATATGCTACCTCTCAGGC
EWS FLI1 23441188 CTGTCAAGGACAGTTTGGGAAATCacATATTTTGTTCAATAAAGAAACTG
EWS FLI1 23441188 CTTCAGAATTTAGGATCATTGCTCtgGGAGAGGGAGAGGAAGCTTCTTCC
EWS FLI1 23441188 CTTCGTTGGGTCGGGGAGAACAAAggGAGACACACCTAGGAAATATGAAG
EWS FLI1 23441188 GAGACCCTGTCTTTTTAAAGATAAatCTTCTGAAAGTCAGAGTGTTAATA
EWS FLI1 23441188 GAGAGAAAACCAAATAAGAATCAAtaGAAAAGCCCGAGAGCCCTCAGAGA
EWS FLI1 23441188 GAGTAAATTCAACATCGTTTTTGGcaAACCCTGCCGGAGGCCTTCCCAGC
EWS FLI1 23441188 GGCAACATAGTGAGACCCTGTCTTtCAAGTCCGGGCCTTTGGTGTGTTCT
EWS FLI1 23441188 GGTCCCATAATCCTTAAACTATAAcaTTATTATTGAAAGCTAATTACAAT
EWS FLI1 23441188 GTACATCAGGCAGTGGTGTAAATGcACTTTGTGTTTCCTGTTAACAATTT
EWS FLI1 23441188 GTTTCACTCTTGGGGCTGAGGCTGgCTGGAGCCAGGGCTACTGACTTTCC
EWS FLI1 23441188 GTTTGATAGCATTCTTCTTAGTATgtAAGTGCTTGGATGTATCAGAGAAC
EWS FLI1 23441188 TAATTTTGTTTCATCCATAGGATTtcAGAGAGAAACAGAGATCGGGGGAG
EWS FLI1 23441188 TACCTAATTTTGTTTCATCAAGAAatGTAAAATCCCAAGACCACAGACTT
EWS FLI1 23441188 TACTTCGTTGGGTCGGGGAGAACAaaACCAGGTTAAAAGCTTCACACAGA
EWS FLI1 23441188 TGAGACCAGGAGTTTGAGACCACCcGTCTGCTTTCTATCTGACCCTCTTC
EWS FLI1 23441188 TGCATGCGTAGAGTTCAGCAGCCTtgTGGCCCATGGACAAAGCAAAACAA
EWS FLI1 23441188 TGCCTTGGAATTGAGGATTTTGTGaaACCATTATCCTTCCTTTCTCTAAG
EWS FLI1 23441188 TGGTCCCATAATCCTTAAACTATAggCTTTGGCAGTTTCCACTGGTGCCT
EWS FLI1 23441188 TGTTTTTTTGTTGCTGTTTGTTTAtgGCCTGTTTACCCTGATGTGCTGGC
EWS FLI1 23441188 TTCATTCCGACAGGACCACCCCAGtgGTGTGTTCCTATAGTCCCAGCTAC
EWS FLI1 23441188 TTCCGGACCAGGAGAGAACCGGAGttCCTGTAGTCCCCTCCCCACCTAGG
EWS FLI1 23441188 TTGTCCCCAACTTCTATTTGACTGaTAAGCGTGGACAAACGGGCTTCAGA
EWS FLI1 23441188 TTTAAGAAAATAGAAAAGGAAAGGgaAGATCTTTGAGATCTGCAAATAAA
EWS FLI1 23441188 TTTGATAGCATTCTTCTTAGTATGcgATATCAGCATTCTGAGATTACAGA
EWS FLI1 23441188 TTTTTTAAAAAATAGAATGAACTTcTTTATCAATATACCAGTAGGGCCTG
EWS FLI1 23441188 gcagtggtgtaaatGCactttgtgtttcct
EWSR1 FLI1 18602673 agcagcagctacgggcagcagaAcccttcttatgactcagtc
EWSR1 FLI1 AJ229311 AAGGTTGTATATTGAGGAAATTTGAGCAAGCTGCCCTGAAGAAAGGCATAGTGACAAGATGAGAGAGATGCATTGTTTGGAGATGTGTTTAGCCAGTGCCCTTCTTCCCCACGATCAGGTTCCTGGAGCTTAGGATGTGTGATGCAGAAGAAGTCTGGAAAGGTAAGAAACAGAATTGTA
EWSR1 FLI1 AJ229320 CAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGCATGGAGGACACATAAAGGGTTCCTGGAGGTTGACAATCACAGTTACCCTCTCATACTCACATGCAAGGACGAGGAACTTGTTTCCTATTAC
EWSR1 FLI1 S62665 AGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTCCTCCCCTTGGAGGGGCACAAACGATC
EWSR1 FLI1 S64709 TACGGGCAGCAGAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCA
EWSR1 FLI1 S72620 CCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGAATCCGTATCAGATCCTGGGCCCGACCAGCAGTCGCCTAGCCAACCCTGGAAGCGGGCAGATCCAGCTGTGGCAATTCCTCCTGGAGCTGCTCTCCGACAGCGCCAACGCCAGCTGTATCACCTGGGAGGGGACCAACGGGGAGT
SLC45A3 FLI1 22081504 gacagccgcgcgcctcggccagGaggctctgtcggtggtgagcgacga

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)