TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'FIP1L1'. The HGNC name for this gene is 'FIP1L1'.

16 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
FIP1L1 PDGFRA 12660384 AAAATTTAAACGAGGGTCATTGAATCAATCAGCCCGGATGGACATGAATATATTTATGTGGACCCGATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGA
FIP1L1 PDGFRA 12660384 AATATTTCAGTCTGGTCTTCTTCTGTATACCGGTTTCCTTTTAGGAGACTGCTAcAGATGGGAGTTTCCAAGA
FIP1L1 PDGFRA 12660384 AGCAAATGCTTTGTTTTAATCTTAATGCaCAGCCCGGATGGACATGAATATATTTATGTGGACC
FIP1L1 PDGFRA 12660384 ATAAGTTATTTAATTTGTTATAATGATTTGTTAATTTATGAtCATGAATATATTTATGTGGACCCGATGCAGCTGCCTTATGAC
FIP1L1 PDGFRA 12660384 ATATGGGAGGGCCGAATCACCTGATCTAAgCCCGGATGGACATGAATATATTTATGTGGA
FIP1L1 PDGFRA 12660384 CCTCTGATTCCACCACCGGCACAGTGTCCtCCGATGCAGCTGCCTTATGACTCAAGATGG
FIP1L1 PDGFRA 12660384 CCTCTGATTCCACCACCGGGAGACTGCTAcAGATGGGAGTTTCCAAGAGATGGACTAGTG
FIP1L1 PDGFRA 12660384 CGACGGGCAAATGAGAACAGCAACATACAgCTGCCTTATGACTCAAGATGGGAGTTTCCA
FIP1L1 PDGFRA 12660384 CTTGTTAAATGATCTTTATGAAGTACTTTTTTCTTGTgTGGACATGAATATATTTATGTGGACCCGATGCAG
FIP1L1 PDGFRA 12660384 TGCCTGGCTTATTTCACTTAGCACAGTGTCCtCCGATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGA
FIP1L1 PDGFRA 12660384 TTTGTTCAAGACTGGGCTTCCACCGAGCAgAGATGGACATGAATATATTTATGTGGACCC
FIP1L1 PDGFRA 12660384 TTTTTAACATTAGACTTCTAATGTTTTTAAAAGTAAAGTCcATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGA
FIP1L1 PDGFRA AY229892 ACTATCAGCCGAGTAGAAGGCAGGCGACGGGCAAATGAGAACAGCAACATACAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGAGATGGACTAGTGCTTGGTCGGGTCTTGGGGTCTGGA
FIP1L1 RARA 17301809 catttccatatggcaAtgccattgagacccagagca
FIP1L1 RARA 18603554 tctgcacgtgcatttccatatggcaatgCCATTGAGACCCAGAGCAGCAGTTCT
FIP1L1 RARA 21750086 caccaccggCcattgagacccaga

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)