TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'FGFR1'. The HGNC name for this gene is 'FGFR1'.

22 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BCR FGFR1 AJ298916 GAGTTCTATGATGGGCTCTTCCCCCGCGTGCAGCAGTGGAGCCACCAGCAGCGGGTGGGCGACCTCTTCCAGAAGCTGGTGTCTGCTGACTCCAGTGCATCCATGAACTCTGGGGTTCTTCTGG
BCR FGFR1 AJ298918 CCTGTTGGAGAGGCAGGACCTGCTGCTTTAGAGGAGTGCAGCTGAATCAGCACCACCTCTCTCTCTGGGCCTCTAATGCCCTGCCCTCTCCA
CNTRL FGFR1 10688839 ATCCCTCTGCGCAGACAGatggcaaaccaaaaagatttggag
CNTRL FGFR1 10688839 GAGTACACGGAGCTCAAGAAACAGgtgtctgctgactccagtgcatcc
CNTRL FGFR1 10688839 GAGTACACGGAGCTCAAGAAACAgGTGCTGCTGACTCCAGTGCATCC
CNTRL FGFR1 18295660 CGGAGCTCAAGAAACAGgtgtctgctgactcc
FGFR1OP FGFR1 11550283 AAAGGGCCAACCACTGGGGAaGTGTCTGCTGACTCCAGTGCA
FGFR1OP FGFR1 11550283 GCACAGACAACACCAAGTAAgGTGTCTGCTGACTCCAGTGCA
FGFR1OP FGFR1 11550283 GGGCAGAAGGCTGGTGACAAgGTGTCTGCTGACTCCAGTGCA
FGFR1OP2 FGFR1 15034873 AAGTTAAAAGAGCAGCACTCCAAgGTGTCTGCTGACTCCAGTGCATCC
FGFR1OP2 FGFR1 15034873 CACCCCGTCCCCCCTCCTTgCTCTAGGGTGACCCCACT
LRRFIP1 FGFR1 19369959 gtcaaggaggccctgaagcaaagagaggaaatgctcgagGtgtctgctgactccagtgcatccatg
MYO18A FGFR1 15800673 cgagagattgcccagctcaagaaccagGtgtctgctgactccagtgcatccatg
TRIM24 FGFR1 15609342 TCCCTCTGCGCAGACAGattgactgttcaagtactattatgct
TRIM24 FGFR1 15609342 ctgactaagaatgggaaggagtcaccccgtcccccctCacaacagtaatgtattcagtgaggttagtgctgtagatata
TRIM24 FGFR1 15609342 cttccctctcttccggatGTGTCTGCTGACTCCAGTGCATCCATGAA
ZMYM2 FGFR1 9889006 AATTTGAATTCCAAAAGTAgACACTGCAAGTCCTCCGGAC
ZMYM2 FGFR1 9889006 ACATATGTGGATGATTTTTtGCAAAGAGTCAGGAGAACAG
ZMYM2 FGFR1 9889006 TCAAAATGATTTGGTTAATtACAGAATGTGCAGCCAATAG
ZMYM2 FGFR1 9889006 TGAGATAGCGCCATTGCACtTTTCACACTGCTGAGAAAGA
ZMYM2 FGFR1 9889006 TTACAATGACGGATATGATgTGGGAAGGAGTCACCCCGTC
ZMYM2 FGFR1 9889006 TTTTAATGTTTAGTAAACCtCATCTCAGCCATACCATACC

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)