release 3.3 (August 2013)
Department of Biochemistry and Genetics

You have searched for 'FCGR2B'. The HGNC name for this gene is 'FCGR2B'.

1 record(s) found.


Click on an HGNC name to search for that gene.

Ig FCGR2B AF209720 ctcagagcatctttgtgtatgctttctgtgggcccagtctgccctgactcaacctgcctc

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)