TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'EWSR1'. The HGNC name for this gene is 'EWSR1'.

58 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
EWSR1 ATF1 17188428 gcatttacaccactCtattcatttact
EWSR1 ATF1 17188428 ggctaacatatagtAgatgggacatat
EWSR1 ATF1 17188428 tagtgccttggaattgagAactatcacttaagtaa
EWSR1 ATF1 17188428 tattgcaggccactatCaagaccagtctcagaaaaag
EWSR1 ATF1 17188428 tgcttttggagacatcttaTctgaccacctgttgccgt
EWSR1 ATF1 18300800 ggtggaatgggAaaaattttg
EWSR1 ATF1 19561568 cggtggaatgggAaaaattttga
EWSR1 ATF1 19561568 cttgatctagTtgccattgc
EWSR1 ATF1 19561568 gggcagcagaTtgccattgc
EWSR1 ATF1 8401579 ATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGgAAAAATTTTGAAAGACTTATCTTCTGAAGATACACGGGGCAGAAAAGGAGA
EWSR1 ATF1 AF047022 AACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGATTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACAGGGACTTCAGACATTAACCATGACAAATTCAGGCAGTACTCAGCAAGGTACAACTATTCTTCAGTATGCACAGACCTCTGATGGACAGCAGATACTTGTGCCCAGCAATCAGGTGGTCGTACAAACTGCATCAGGAGATATGCCAACATATCAGATCCGAACTACACCTTCAGCTACTTCTCTGCCACAAACTGTGGTGATGACATCTCCTGTGACTCTCACCTCTCAGA
EWSR1 CREB1 17000668 gaaccctataaactActcagttaaaatcagttttgtagttttatat
EWSR1 CREB1 17000668 tacgggcagcagaTtgccattacccaggga
EWSR1 CREB1 17000668 ttacattctatccacggggatttctAcagggagaattgtc
EWSR1 CREB1 19561568 gggcagcagaTtgccattac
EWSR1 DDIT3 16884691 attgtgggagttcagccaggtgcagtggctcacgcctgtaaTtaggaaaatgctatgatttgttcccttccctgtagttta
EWSR1 DDIT3 16884691 caccccgtgagggcagaggcatgccaccaccactccgtggagTgttcaagaaggaagtgtatcttcatacatcaccacac
EWSR1 DDIT3 Y10005 TAACATCTTGGATGCCCCAGTGAAGATTTCAGTGCTTTTTTCCAATTTGTTTTTAGTATGCCCTTCCCTGTAGTTTAGTTTTTACCCTGGCAGATTTGAGGCCTGCTTTGGATTTAGAGA
EWSR1 ERG 20633768 tacgggcagcagaGcagtggccagatc
EWSR1 ERG S70579 AGCCCACAGAGCAGCAGCTACGGGCAGCAGAATTTACCATATGAGCCCCCCAGGAGATCAGCCTGGACCGGTCAC
EWSR1 ERG S70593 AGCCCACAGAGCAGCAGCTACGGGCAGCAGAGCAGTGGCCAGATCCAGCTTTGGCAGTTCCTCCTGGAGCTCCTG
EWSR1 ERG S72622 ATGGATGAAGGACCAGATCTTGATCTAGATTTACCATATGAGCCCCCCAGGAGA
EWSR1 ERG S82335 CTATTCCTCTACACAGCCGACTAGTTATGATCATCAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAG
EWSR1 ERG S82338 TGTCTAGGATTTGACTTTGTTTCTTTTTGCTGAAGATCCTTCAGTTACTCTCAGCAGAACACCTATGGGCAACCGAGCA
EWSR1 ETV1 7700648 AGCCAACAGAGCAGCAGCTCAGGGCAGCAGaGAGACATCAAACAAGAGCCAGGAATGTATCGG
EWSR1 ETV4 AB005537 AATATTTGCAGTTCTTCTGTATGGAGAGAGGTAACCAAAACACATAATTATGTTCAGAATTTAGGATCATTGCTCTTTTTAAATTACATTCTATCCACGGGGATTTCTCAACAACTCAAAGGAGTAGTGTTGATTTATGGAGCTCAGCCCCTAGCAGTGTGCTAAAGCCCTAAGAAACCTGGCTCTGTTTTCATTTCTTGAGTTTAGCTCAAAAGAAGCTGCTTTTGGAGACATCTTAGGATATAGAACCCTATAAACTATATGTTAGCCAGAGCCTTTGTTACATTAGTAGCCCTAGATCTGAGTTTATTAGAGTAGGCCCAGAGCTAGCTAGAACTTTAGAATTTCCCTTTTTGTGGTGCCCACAACCGTTCAAGGGCAGGGGGATGA
EWSR1 ETV4 AB005538 GGACCACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGATATGTAGATCCTGCCCTCAGGTAGCTTGTGACTTAATAGGGAGGTTAAGGCATTTATTTCTATTTAACAGGTGTTTGAGGTTTTAATTACCTATTAAGACC
EWSR1 FEV 10976720 AGCTACGGGCAGCAGaATCCCGTCGGAGACGGTCTCTTCAAG
EWSR1 FLI1 18602673 agcagcagctacgggcagcagaAcccttcttatgactcagtc
EWSR1 FLI1 AJ229311 AAGGTTGTATATTGAGGAAATTTGAGCAAGCTGCCCTGAAGAAAGGCATAGTGACAAGATGAGAGAGATGCATTGTTTGGAGATGTGTTTAGCCAGTGCCCTTCTTCCCCACGATCAGGTTCCTGGAGCTTAGGATGTGTGATGCAGAAGAAGTCTGGAAAGGTAAGAAACAGAATTGTA
EWSR1 FLI1 AJ229320 CAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGCATGGAGGACACATAAAGGGTTCCTGGAGGTTGACAATCACAGTTACCCTCTCATACTCACATGCAAGGACGAGGAACTTGTTTCCTATTAC
EWSR1 FLI1 S62665 AGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTCCTCCCCTTGGAGGGGCACAAACGATC
EWSR1 FLI1 S64709 TACGGGCAGCAGAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCA
EWSR1 FLI1 S72620 CCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGAATCCGTATCAGATCCTGGGCCCGACCAGCAGTCGCCTAGCCAACCCTGGAAGCGGGCAGATCCAGCTGTGGCAATTCCTCCTGGAGCTGCTCTCCGACAGCGCCAACGCCAGCTGTATCACCTGGGAGGGGACCAACGGGGAGT
EWSR1 NFATC2 19318479 tgggcggggaggaggacgcggtggaatgggCatcccagtgactgcatccctccctccact
EWSR1 NR4A3 12378528 AACCCATGATCCACATCTACCTGGACAAGGAAACAGGAAaGATATGTTTTATTAGTTAGAATTGGGATATATATATGTGT
EWSR1 NR4A3 12378528 AGAGTTTGAAGCTCCAGTGAGCTGAGATTGCACCACTGCaGATTTCATCCCAACAACTGGACAGCAAGATAAGTAACTGG
EWSR1 NR4A3 12378528 ATCTTAACCAGTGTACATTTGCATATAGATAAAACCTTtTCTCTTGTCCCCTATGCAGATATGCCCTGCGTCCAAGCCCAATA
EWSR1 NR4A3 12378528 CCAAGGAGTTCACTAGCAGCCTGGGCAACCTAGTGAGACaGACTTCAAGTTTCCCAAATCTAGTGGAGGACAGGGCAAGG
EWSR1 NR4A3 12378528 CCACTGCACTCCAGCCCGGGCAACAGAGTGAGACTCCCaTTCACGGTTTCCTCCACACACTTCACCACCGGGAGGGAAC
EWSR1 NR4A3 12378528 GATGCTTTATCGTGATGTAAAGAAGATGGTGCCTTGGTTaAAGGGGCTTTGACAGAGGTAGTTATTTCTTCCTAATTTACAAC
EWSR1 NR4A3 12378528 GCTTCCCACCAGCTTATTTTCCTCCTTATGGTAGACAGTgAAATCATCCACTACATCCAATAATTCTCAGCGCCTTCTCACTC
EWSR1 NR4A3 12378528 GGCCATGTCCAGTGGCTTGCACCTGTAATCCCAGCACTTtAGGTTATAGCTGAGGAGCCCACTCCAATTAGTTTATAGGA
EWSR1 NR4A3 12378528 GTGAACAGGGAGTACAGGGGAGTAATTGATGTTCtTGTTGAATGACAGAAAAGAGTAATGGAGAAATCCTAGCGGTGCTG
EWSR1 NR4A3 12378528 TCTAGCTAGAAACCTCAGAAAGACACAAATAAGAGCAGTAAAAaGGGAGCAAACTTAAAGTCTCCCTTGCTCGGAAAGAAGC
EWSR1 NR4A3 12378528 TTAAGTGTATTTAAGTATGGCCTTTTTCTGGCCAGGCACaCAAAGAGTAAATTTGAGTTTGGCAAAAGAACAGATTGCAC
EWSR1 PATZ1 AF254088 GGGAAGAGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGGTGTGGCATCCAGTGCCCCTCCCCTGACTGGCAAGCGAGGCCGGGGCCGCCCAAGGAAGGCCAACCTGCTGG
EWSR1 PBX1 18383210 ggaggactcggtggaatgggGcggaagagacggaatt
EWSR1 POU5F1 15729702 TACCCTCCTACCAGtttttagtaggtggggttcactatTGAAGCTGGAGAAG
EWSR1 POU5F1 18338330 atggacagagtaactacagttatccccagTcccaggacatcaaagctctgcagaaag
EWSR1 POU5F1 20815032 ggacagagtaactacagttatccccagTcccaggacatcaaagctctgcagaaag
EWSR1 SMARCA5 21113140 gggcagcagaAtgtaaatgg
EWSR1 SP3 17690209 caagctccaagtcaatatagccaacagagcagcagctacgggcagcagaGatgtggtaaagtctatgggaagacctc
EWSR1 SP3 17690209 tgagagccttgtatacacttctCAACACATTTGTCATATACCAGGATGTGGTAAA
EWSR1 WT1 16730884 AGCCAGCAGCCACTGCACCTACAAGgTGAAAAGCCCTTCAGCTGTCGG
EWSR1 WT1 16730884 gcttatccagcctatgggcagccagcagccactgcacctacaagctgaaaagcccttcagctgtcggtggccaagttgtcagaaaaagtttgcccggt
EWSR1 WT1 S79672 AGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTGAGAAACCATACCAGTGTGACTTCAAGGACTGTGAACGA
EWSR1 ZNF444 19760602 acgcggtggaatgggCcactcgggcgagaa

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)