TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'ETV6'. The HGNC name for this gene is 'ETV6'.

70 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CHIC2 ETV6 10477709 ATTTGCCTCAGTAAAAGaCAGGAACGAATTTCATAT
CHIC2 ETV6 10477709 GCCTGCCTGCGCACCTGcATTTGGACTGAGCAACA
CHIC2 ETV6 10477709 GCTCAGTGTAGCATTAAgACACGAAGATCGATTGAG
ETV6 ABL1 7805037 CCGGAGGTCATACTGCATCAGAACCATGAAGAAgAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAG
ETV6 ABL1 7805037 CTTTCCAGCGGATGCTTCATGTGGTGCCAGCCATaAGACGAAAACAAGAGAAGATCCCAAAGAAAATAGAAA
ETV6 ABL1 9365838 GCCATGCCCATTGGGAGAATAGCAGaAGCCCTTCAGCGGCCAGTAGCATC
ETV6 ABL2 10706884 CCTGAAGAGCACGCCATGCCCATTGGGAGAATAGCAgATCACTTTGCCAGCTGTGTGGAGGATGGATTTGAG
ETV6 ACSL6 10502316 ATGTCTGAGACTCCTGCTCAGTGTAGCATTAAgAGTTTGTCCTCTCACTTCTGGAGAAGATGCAGACACAGGAGATC
ETV6 ACSL6 10502316 CCTGATGACCTCTCCATTGTGTGTTTCACAAGCGGCACGACAgGTAGACAGCTGCCACAT
ETV6 ACSL6 10502316 TATCTGAGACTCCTGCTCAGTGTAGCATTAAgAAAACAAATTCCAGTACTCCTGGTAAGAAAAACAGAGGCCTTTTAACA
ETV6 ACSL6 10502316 TGGAGGAAGACTCGATCCGCCTGCCTGcTCTGTCGTCTATTGCCACGGAGGGCGTGTTGGCTTCTTCCAGGGAGATATCCGCCTTCTCT
ETV6 ACSL6 17889716 CTGCTCAGTGTAGCATTAAGagtttgtcctctcacttctgg
ETV6 ARNT 20804916 tgcatcagaaccatgaagaagAaatgacatcagatgtaccat
ETV6 BAZ2A 16643428 CCTGCCTGCGCACCTGCgGAAAATCAACTTGCTGTTCTGT
ETV6 CDX2 9920852 CTGCCTGCGCACCTGcTGAAAACCAGGACGAAA
ETV6 CDX2 9920852 TGCAAATGCATAAACAACCACTGCTCCTGTCTCCAAGCTCAGATTCCTACCAAGATAGCCTTTTCtCTTCCCCTCTCTTTTGTAAGTCTCTTGATTTCATTCTTTGAACCTGTGATTGGAAGTTAAAGTGCACCAGGTTGGAAGGAAGAACTCTTAAC
ETV6 FGFR3 11731410 GTGCACCATAACCCtGTGCACAAGATCTCCCGCTTCCCGCTCAAGCGA
ETV6 FLT3 16761019 CGGGCTGCATAGGGAAGGGAGCCAGCTACAGATGGTACAG
ETV6 FLT3 16761019 CTCTATCTGCAGAACTGCCTACCACACAGCTCTCTCTGTA
ETV6 FLT3 16761019 aggccgcaccaggagaGcacactgtcagga
ETV6 FLT3 16761019 cacaagtacaaaaagActgtagactgcttt
ETV6 FLT3 16761019 cctcccaccattgaaCtgttgctatggtga
ETV6 FLT3 16761019 cctctgatcctgaaGatcttctttgctttg
ETV6 FLT3 16761019 ctgcatagggaagggaGccagctacagatg
ETV6 FLT3 16761019 gacaaccatgaagAagaaaaagcagacagc
ETV6 FLT3 16761019 tccccggctgagagaTtttcaaggaacaca
ETV6 GOT1 18310541 TTCGCTATCGATCTCCTCATTCAGcatatcgcacggatgactgccatccctgggtttt
ETV6 ITPR2 20033038 cgcacctgcCaaaaaatc
ETV6 JAK2 9326218 AGTGGGACAAAGAAGAACTTCAGCAGTCTTAA
ETV6 JAK2 9326218 TTGATAACCTCAAACATATgGACAATCTGTATGTTGTGTC
ETV6 JAK2 9326218 TTTTTAAATATAACAAAAGCATACAGAGTGAT
ETV6 JAK2 9360930 ATGCCCATTGGGAGAATAGCAgATAAATCAAACCTTCTAGTC
ETV6 JAK2 9360930 ATGCCCATTGGGAGAATAGCAgATTATGAACTATTAACAGAA
ETV6 JAK2 9360930 CTGCATCAGAACCATGAAGAAgTTCTTCAGGAGAGAATACCA
ETV6 LYN 19710703 tgggagaatagcagAgcaggcagatggctt
ETV6 MDS2 12203785 GAAGACTCGATCCGCCTGCCTGCGCACCTGCCTGCAGTGTTCTGAATAGCAGTCCAGCTATG
ETV6 MECOM 9044825 CTGCGCACCTGCatcttagacgaa
ETV6 NKAIN2 9087565 CTGCCTGCGCACCTGcACCAAATTATGATTGTATGTCCCAGAAATTCACTTAGAAGCTAA
ETV6 NTRK3 20410810 ttgggagaatagcagAtgtgcagcacatta
ETV6 NTRK3 21401966 gaatagcagAtgtgcagcacatt
ETV6 NTRK3 9811336 CCATTGGGAGAATAGCAGATGTGCAGCACATTAAGA
ETV6 NTRK3 9949179 ATACTGCATCAGAACCATGAAGAAgATGTGCAGCACATTAAGAGGAGAGAC
ETV6 PDGFRA 17555450 CACTGTATTCTTGCTTCCACAAcagttacctgtcctggtcatttat
ETV6 PDGFRA 17555450 TGGGGAAACCATAAGaaaccgaggtatgaa
ETV6 PDGFRB 17122866 ggcttttgttcagGtgtccacgtgagc
ETV6 PDGFRB 8168137 GAGGTCATACTGCATCAGAACCATGAAGAAgCCTTGCCCTTTAAGGTGGTGGTGATCTCA
ETV6 PER1 12661008 ACTCCTGCTCAGTGTAGCATTAAgGCTTCTCTCACCATCACATCAAGAGCCCGAG
ETV6 PRDM16 22050763 cagaaccatgaagaagGtgacggtgacgttgta
ETV6 RUNX1 AF044317 GTGTATATATGTATATATGTGTGTATATATGTATATATGTATATGTGTATATATATAATCTTGCCAAATACTACAAATTTTATAAATCGTTCCTTTACTGGCTGTTTGGTGATATATCTTTTATATGC
ETV6 RUNX1 AJ494735 CTTGTCGAAGCCACAGCACAGTACCTACAAATAGCACCCACTGAGAGTAAAATGTTTACTAAGCATTCCTAAATTTTAAAAAGATTAATTTTAAAATGTCCTCAGCTTGCTACTTGTGAGGACACAATGGGTTATGAAGT
ETV6 RUNX1 AJ494736 AGCCACAGTTCCCACAGTCAGAGTCACCAAGCCACATAGTTTTTCTTTTCCCACCATTTTTCACTTCTTTAGAATTATAAGATAAGCCTGTTACATATCCTGAATCATTGGTCCCATTCTATGTATATGCAAAAGAAGTT
ETV6 SYK 11159536 CAAAAAATCGGCACACAGgACTGTAGACTGCTTTGGGAT
ETV6 SYK 11159536 CCCATTGGGAGAATAGCAgGAAATGTTAATTTTGGAGGC
MN1 ETV6 15334551 GGAGAAGGCCAAACCCCAGAACCCCAACAGCAAAGAAgGCTTGCAGCCAATTTACTGGAGCAGGGATGACGTAGC
MN1 ETV6 X85024 CGCTATCGATCTCCTCATTCAGCCCACGACCTCCCTGCAAACAAG
MN1 ETV6 X85026 ATCCGCCTGCCTGCGCACCTGCCCCACGACCTCCCTGCAAACAAG
MNX1 ETV6 11454678 ATCAAGCTGGGCGCCGGCACCTTCCAGCTGgACCAGTGGCTGCGCGCGTCCACCGCGGGC
MNX1 ETV6 18940475 atgcccgacttcaactCAGGAACGAATTTCAT
MNX1 ETV6 18940475 atgcccgacttcaactGCTTGCAGCCAATTT
PAX5 ETV6 11406533 CCAACCAACCAGTCCCAGCTTCCAGTCACAGCATAgGCTTGCAGCCAATTTACTGGAGCAGGGATGACGTAGCCCAGTGG
PAX5 ETV6 17344859 gtcccagcttccagtcacagcatagGcttgcagccaatttactggagc
PAX5 ETV6 18697940 TCCAGTCACAGCATAGgCTTGCAGCCAATTTA
PAX5 ETV6 18957548 aagggctgccagtggggttAgtactttttttgttcgacttgtt
PAX5 ETV6 18957548 catgtgtctatttaaggtgTagataatggcatgatgaaacagaggaaaaaaagg
PAX5 ETV6 18957548 gataattctgcataaaacacTttgtcagcacttcttttttttttgtttctg
PAX5 ETV6 18957548 gtttgcaagacagagatgaagctGgagtgcagtggcgtgatctcagctcactgcaagtt
PAX5 ETV6 18957548 ttgcaatcatcaaatgaaaagAatattttattaaaagtgatgtcga
PAX5 ETV6 18957548 tttcctccctgccatgaaataGgataaactttttttttttttttttttgagacagag
PAX5 ETV6 18957548 ttttctgcatcattagtcagtaaTaaattcattagaataacagaatttagacattt
PAX5 ETV6 18957548 ttttgttctgtcccagaaatttTagctaggatggtctcagtctcctg

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)