TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'ETV4'. The HGNC name for this gene is 'ETV4'.

5 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CANT1 ETV4 18794152 cagcggcaggcctggggatggcctcgggagCtcaggtaccagacagtgatgagcagt
EWSR1 ETV4 AB005537 AATATTTGCAGTTCTTCTGTATGGAGAGAGGTAACCAAAACACATAATTATGTTCAGAATTTAGGATCATTGCTCTTTTTAAATTACATTCTATCCACGGGGATTTCTCAACAACTCAAAGGAGTAGTGTTGATTTATGGAGCTCAGCCCCTAGCAGTGTGCTAAAGCCCTAAGAAACCTGGCTCTGTTTTCATTTCTTGAGTTTAGCTCAAAAGAAGCTGCTTTTGGAGACATCTTAGGATATAGAACCCTATAAACTATATGTTAGCCAGAGCCTTTGTTACATTAGTAGCCCTAGATCTGAGTTTATTAGAGTAGGCCCAGAGCTAGCTAGAACTTTAGAATTTCCCTTTTTGTGGTGCCCACAACCGTTCAAGGGCAGGGGGATGA
EWSR1 ETV4 AB005538 GGACCACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGATATGTAGATCCTGCCCTCAGGTAGCTTGTGACTTAATAGGGAGGTTAAGGCATTTATTTCTATTTAACAGGTGTTTGAGGTTTTAATTACCTATTAAGACC
KLK2 ETV4 18451133 cttatccttggtttcAggtctgaggggggg
TMPRSS2 ETV4 18794152 caagatggctttgaactcaGtctcggcccccgcttggggcccc

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)