TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'ETV1'. The HGNC name for this gene is 'ETV1'.

11 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
ACSL3 ETV1 18594527 ctgtgtcacaccaccttagcctcttgatcgaggaagTGCCTATGATCAGAAGCCACAAGTGGGAATGAGGC
ERVK-17 ETV1 18794142 AGTTAGAAGATTTGAATCAAtGTTTTCAATGTAAGGATAC
EWSR1 ETV1 7700648 AGCCAACAGAGCAGCAGCTCAGGGCAGCAGaGAGACATCAAACAAGAGCCAGGAATGTATCGG
HMGN2P46 ETV1 17671502 TTGACTGGACACTTGAAGCTTGCCCTGTATGAACAGCCCCCATCTTCCCATGCTTGTCAAAAATCAGAGGCAACTAACACTGCGGCTTCCTGAGTGCCTATGATCAGAAGCCACAAGTGGGAATGAGGCCCTCCAACCCCCCCACATCATCCAGCACGCCAGTGTCCCCACTGCATCAT
HMGN2P46 ETV1 17671502 caactaacactgcggcttcctgagTgcctatgatcagaagccacaagtg
HNRNPA2B1 ETV1 17671502 gagtccgcgatggaGagtcagcgtgggagaaattgtaacg
SLC45A3 ETV1 17671502 CCCTGGGTACCAGCCCCACCCCTCTATCCCCCCTCGCAGCACCCCCCACCTCCGTCCCGCCTCGCCCCGCCCCCCTCCTGGCAGTCCCAGCGCGCATGCTCTCTCCCCCCGCGGAGTAACCTGGAGATTTAAAAGCCGCCGGCTGGCGCGCGTGGGGGGCAAGGAAGGGGGGGCGGAACCAGCCTGCACGCGCTGGCTCCGGGTGACAGCCGCGCGCCTCGGCCAGTGGCTTTTCATGGCCTGCCACTGAAAATCAAGAAAGAACCCCACAGTCCATG
TMPRSS2 ETV1 DQ204770 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGCTCAGGTACCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTT
TMPRSS2 ETV1 DQ204771 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCACTCAGGTACCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTT
TMPRSS2 ETV1 DQ204772 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGTCCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGCAGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCCTAGCCAGGTGAATGGCTCAAG
TMPRSS2 ETV1 DQ204773 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTTATTCCAGGATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTCACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAG

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)