TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'ERG'. The HGNC name for this gene is 'ERG'.

26 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
EWSR1 ERG 20633768 tacgggcagcagaGcagtggccagatc
EWSR1 ERG S70579 AGCCCACAGAGCAGCAGCTACGGGCAGCAGAATTTACCATATGAGCCCCCCAGGAGATCAGCCTGGACCGGTCAC
EWSR1 ERG S70593 AGCCCACAGAGCAGCAGCTACGGGCAGCAGAGCAGTGGCCAGATCCAGCTTTGGCAGTTCCTCCTGGAGCTCCTG
EWSR1 ERG S72622 ATGGATGAAGGACCAGATCTTGATCTAGATTTACCATATGAGCCCCCCAGGAGA
EWSR1 ERG S82335 CTATTCCTCTACACAGCCGACTAGTTATGATCATCAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAG
EWSR1 ERG S82338 TGTCTAGGATTTGACTTTGTTTCTTTTTGCTGAAGATCCTTCAGTTACTCTCAGCAGAACACCTATGGGCAACCGAGCA
FUS ERG 19737655 gtggaggtggagAtttaccatatg
FUS ERG Y10001 ATCCTTTTGATCGTTGTGTCCAAGGCTTGTGTGTGTGTGAGTGTGTGGGAGACAACTCCGAACAGTCCTGAGCCCTATGTCTTTATGGCTACTGGGTAAAATAGTCAAGTGAGAAATTAG
NDRG1 ERG 19649210 gagtttgatgtccagGaagccttatcagtt
NDRG1 ERG 19649210 gtggagaaaggggagGaagccttatcagtt
SLC45A3 ERG 19649210 gcgcgcctcggccagGaagccttatcagtt
TMPRSS2 ERG 16254181 agcgcggcagGaagccttat
TMPRSS2 ERG 16575875 CGCTGGCCTACTCTGGAAGTTCagAACTCTCCTGATGAATGCAGTGT
TMPRSS2 ERG 16575875 CGGGGAGGACGAGAATCGGTGTggAAGCCTTATCAGTTATGAGT
TMPRSS2 ERG 16575875 GCAAGATGGCTTTGAACTCagAAGCCTTATCAGTTGTGAGTG
TMPRSS2 ERG 16575875 GCGCCGCCTGGAGCGCGGCAggAAGCCTTATCAGTTGTGAGT
TMPRSS2 ERG 16575875 GCTGGCCTACTCTGGAAGTTCagAAGCCTTATCAGTTGTGAGT
TMPRSS2 ERG 16951141 agcgcggcagCcgtcaggtt
TMPRSS2 ERG 16951141 agcgcggcagGaactctcct
TMPRSS2 ERG 16951141 agcgcggcagGaagccttat
TMPRSS2 ERG 16951141 agcgcggcagGttattccag
TMPRSS2 ERG 16951141 tgcacctcaaGaagccttat
TMPRSS2 ERG 16951141 tttgaactcaGaactctcct
TMPRSS2 ERG 16951141 tttgaactcaGaagccttat
TMPRSS2 ERG 16951141 tttgaactcaGttattccag
TMPRSS2 ERG 17032499 aactgataaggcttcCtgccgcgctccagg

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)