TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'DDIT3'. The HGNC name for this gene is 'DDIT3'.

10 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
EWSR1 DDIT3 16884691 attgtgggagttcagccaggtgcagtggctcacgcctgtaaTtaggaaaatgctatgatttgttcccttccctgtagttta
EWSR1 DDIT3 16884691 caccccgtgagggcagaggcatgccaccaccactccgtggagTgttcaagaaggaagtgtatcttcatacatcaccacac
EWSR1 DDIT3 Y10005 TAACATCTTGGATGCCCCAGTGAAGATTTCAGTGCTTTTTTCCAATTTGTTTTTAGTATGCCCTTCCCTGTAGTTTAGTTTTTACCCTGGCAGATTTGAGGCCTGCTTTGGATTTAGAGA
FUS DDIT3 AJ301611 TGGTGACTGGAAGTGTCCTAATCCCACCTGTGAGAATATGAACTTCTCTTGGAGGAATGAATGCAACCAGTGTAAGGCCCCTAAACCAGATGGCCCAGGAGGGGGACCAGGTGGCTCTCACATGGGGGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCC
FUS DDIT3 AJ301612 CAGGCTATGGCCAGAGCAGCTATTCTTCTTATGGCCAGAGCCAGAACATGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCC
FUS DDIT3 AJ301613 ATGATCGAGGCGGCTACCGGGGCCGCGGCGGGGACCGTGGAGGCTTCCGAGGGGGCCGGGGTGGTGGGGACAGAGGTGGCTTTGGCCCTGGCAAGATGGATTCCAGACCTTCTGCAGTCAGAAAGTTTCTGCAGTAATTTAGAGATGGTAGTGAATTGATCTAGATTGGAAACAATGGAATTAGAAGTGTTTAGATTCTTCTAAGCAAAG
FUS DDIT3 AJ301614 ATAGGAAGTCATTGGAGGGTTTGAGCAGAGGAATGACCTGTTTTAAAAGGCTCACTCAGGCTGCTGTATGGTGAATAGAGTTGCGAACAGAGGCCATAGGATAACAGGGTTTTGTTGAGAAAGTGGTTTCATTTTGAGGGCTAGGTGGAAAGACCTGAGGTTGTAACCAGTAGTGGAGAGGGAAGGAAAATTAACTCAGGGGGAGTGAAT
FUS DDIT3 Y10002 GTGTGGGAGACAACTCCGAATGTTTAATTCTGGAAGAGGGATGTAACATTGCCCTGAGGATGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGACCAGAGGTGGGTGGATCACCCTG
FUS DDIT3 Y10003 TGAGTGTGTGGGAGACAACTCCGAATGTTTAATTCTGGAAGAGGGATGTAACATTGCCCTGAGGATTCGAGATGGTAGTGAATTGATCTAGATTGGAAACAATGGAATTAGAAGTGTT
FUS DDIT3 Y10004 TGGTTTCTAAAGATGAAATTAAGAATTGTTCCACAAGGGTTAAGTGTCTGGTGGTAAAGTTGGGCTCGGAGGCCTACAGTAACCCAAATATAAGTGCCACGGAGAAAGCTAAAGCAGAGA

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)