TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'CRTC1'. The HGNC name for this gene is 'CRTC1'.

7 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CRTC1 MAML2 12539049 tgagcctgacgcgggccgcgcggCtccagggttccttgaaaagaaaacaggtagt
CRTC1 MAML2 17437281 gccgcgcggCtccagggttccttga
CRTC1 MAML2 17618868 GTCATGAAGGACCTGAGCCTGACGCGGGCCGCGCGGctccagggttccttgaaaagaaaacaggtagttaacctatctc
CRTC1 MAML2 18181164 ggaggagacggcggccttcgaggaggtcatgaaggacctgagcctgacgcGGGCCGCGCgctccagggttccttgaaaagaaaacaggtagttaacctatctcctgccaacagcaa
CRTC1 MAML2 19092631 ggccgcgcggCtccaggg
CRTC1 MAML2 19384064 acgcgggccgcgcggCtccagggttccttg
CRTC1 MAML2 AY186997 AAGATCGCGCTGCACAATCAGAAGCAGGCGGAGGAGACGGCGGCCTTCGAGGAGGTCATGAAGGACCTGAGCCTGACGCGGGCCGCGCGGCTCCAGGGTTCCTTGAAAAGAAAACAGGTAGTTAACCTATCTCCTGCCAACAGCAAGCGACCCAATGGCTTTGTGGACAACTCATTTCTTGATATCAAAAGAATTCGTGTTGGGGAGAAT

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)