TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'CREB3L2'. The HGNC name for this gene is 'CREB3L2'.

12 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
CREB3L2 PPARG 18757431 agcttcaatgacgAaatgaccatggttgacaca
FUS CREB3L2 17721195 AGGTGGCCGTGGAGGCAGAGGTGGCATGcCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAG
FUS CREB3L2 17721195 GCAGAGGTGGCATGGGCGGAAGTGgCAGCCTGAGTCCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGA
FUS CREB3L2 17721195 GTACAACAGCAGCAGTGGTGGTGGAGGTGaAACTGCAGGGATCAGGCCCTCTGGTCCTGACAGAGGAGGAGAA
FUS CREB3L2 17721195 GTACAACAGCAGCAGTGGTGGTGGAGGTGtggtccactggggctgcaaaaaaggaagcacGAGTCCCAACCCACGCCTGCA
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGatgtctTGACTCAGAGGGCAGCCTGAGTCCCAACCCACGCCTGCACC
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGcCTGAGTCCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGA
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGcttccaggaattggctactCCACGCCTGCACCCCTTCAGCCTGCCTCAGAC
FUS CREB3L2 17721195 GTGGTGGCTATGAACCCAGAGGTCGTGGAaACCCACGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAGCCC
FUS CREB3L2 AJ549094 GTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGAGGCCGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAGCCCCTCCAGAGCTGCACCCCGGGCCCCCTCCGCCCTCTCCAGCTCCCCTCTCCTCACGGCTCCTCATAAACTGCAGGGATCAGGCCCTC
FUS CREB3L2 AJ549096 ACCGCCATGGAGGTGCTGGAGAGCGGGGAGCAGGGCGTGCTGCAGTGGGACCGCAAGCTGAGCGAGCTGTCAGAGCCCGGGGACGGCGAGGCCCTCATGTACCACACGGCCCTCGGGACCAAGGATCACGTCATGACTCCGACAAACAAGAAAACGGGACAGCCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGA
FUS CREB3L2 AJ549097 TAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTCACAGCCTCACTCCAAACCCTTTCCTGGGTCGCCCTTCAGCCTGCCTCAGACCCACAGCCCCTCCAGAGCTG

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)