TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'BCL2'. The HGNC name for this gene is 'BCL2'.

18 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
AFF3 BCL2 18622426 AAAAGGAACGGGAGCTGAGAGcatcacagaggaagtagactgatattaac
BCL2 Ig 2284100 AATAAATAAATAGTTATCAGCCCCTGCCGCTGGAAAAAAAAAAAAGTCCCAGCAGATCAGCTGGCCGCAATAGTATTGAATGAATGATGCTGACTCTAc
BCL2 Ig AY137970 CTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGAAGCCACGGCCCTTTAGGATCCCCCATTGGTTCCTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACC
BCL2 Ig AY137971 GTGTCACTGTGGTATTACGATTTTTGGAGTGGTTATCAGGGTAGGGGCCTCAGGGAACAGAATGATCAGACCTTTGAATGATTCTAATTTTTAAGCAAAATATTATTTTATGAAAGGTTTACATTGTCAAAGTGATGAATATGGAATATCCAATCCTGTGCTGCTATCCTG
BCL2 Ig M13418 CACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGGTGCGTGGTTGATGGGGATTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTGAGTCCTCACAACCTCTCTCCTGCTTTAACTCTGAAGGGTTTTACTGCATTTTTGGGGGGAAA
BCL2 Ig M13419 CACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCCCCAGGGAACCCTGGTCACCGTCTCCTCAGGTGAGTCCTCACAACCTCTCTCCTGCTTTAACTCTGAAGGGTTTTACTGCATTTTTGGGGGAAA
BCL2 Ig M13420 TTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGAAAGCAGGAAACCTGTGGTATGAAGCCAGACCCCCGAGTGAAGACTACTACTACTACTACATGGACGTCTGGGGCAAGGGACCACCGGTCACCGTCTCCTCAGGT
BCL2 Ig M13421 CACAGACCCACCCAGAGCCCTCCTGCCCTCCTCGATACGGTATGGACGTCTGGGGCCAGGGGACCACGGTCACCGTCTCCTCAGGTAGGAATGGCCACTCTGGGGCCTTTGTTTTCTGCTACTGCCTGTGGGGTTTCCTG
BCL2 Ig S79218 TTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTTGATACTACTACTACTACTACTACATGGACGTCTG
BCL2 Ig X63225 GGTTTAGAATGAGGTCTTGTGCACTGTGGTATTACGATATTTTGACTGGTTATTCGTGAGGGAGGGTGGCCCTGGGGGGGCAAAATGTAGCGGGGGCTTTCTCATGG
BCL2 Ig X63226 CCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGGCTTCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACCCAGGCGGTGTTTGAAGACCCTTGACTACTGGGCCAGGAACCTGTCACCGTCTCCT
BCL2 Ig X63227 CCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTAGGTTCGGGGAGTTATTATAACCACAGTGTCACAGAGTCCATCAAAAACCCATCCCTGGGAGCCTCCCGCCACAGCCCTCCCTGCAGGGACCGTACGTGCCATGTTAGGATTTTGATCGAGGAGACAGCACCATGGGTATGGTGGCTTTGACTACTGGGGATC
BCL2 Ig X63231 GGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACTATGGTTCGGGGCTTACCTCCACCAAGAAAGCAGGAAA
BCL2 Ig X63232 CCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTAGGTTCGGGGAGTTATTATAACCACAGTGTCACAGAGTCCATCAAAAACCCATCCCTGGGAGCCTCCCGCCACAGCCCTCCCTGCAGGGACCGTACGTGCCATGTTAGGATTTTGATCGAGGAGACAGCACCATGGGTATGGTGGCTAAAGGATTGACTACTGGGGATC
BCL2 Ig X63233 GGTTTAGAATGAGGTCTTGTGCACTGTGGTATTACGATATTTTGACTGGTTATTATAGGTTACGCTCCACCAAGAAGCAGG
BCL2 Immunoglobulin 2284100 TACTTTTACCTTCCATGGCTCTTTTTAAAATTGATACTTTTAAGAGGTGGCTGATATTCTGCAACACTGTACACATAAAAAATACGGTAAGGATACTTt
BCL2 Immunoglobulin 3129686 GACCTTTAGAGAGTTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTa
BCL2 Immunoglobulin 3129686 TTGCTTTACGTGGCCTGTTTCAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGCTTTCTCATGGCTGTCCTTCAGGGTCTTCCTGAAATGCAGTGGTGCTTACGCTCCACCAAGa

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)