TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'BCL11B'. The HGNC name for this gene is 'BCL11B'.

6 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BCL11B TCR 15668700 GAAGGAAAGAAAGAAAGAAAGAAAGAAAGGGAaataaagaaattaaa
Ig BCL11B AY752976 ATGTCCCGCCGCAAACAGGGCAACCCGCAGCACTTGTCCCAGAGGGAGCTCATCACCCCAGAGGCTGACCATGTGGAGGCCGCCATCCTCGAAGAAGACGAGGGTCTGGAGATAGAGGAGCCAAGTGGCCTGGGGCTGATGGTGGGTGGCCCCGACCCTGACCTGCTCACCTGTGGCCAGTGTCAAATGAACTTCCCCTTGGGGGACATCCTGGTTTTTATAGAGCACAAAAGGAAGCAGTGTGGCGGCAGCTTGGGTGCCTGCTATGACAAGGCCCTGGACAAGGACAGCCCGCCACCCTCCTCACGCTCCGAGCTCAGGAAAGTGTCCGAGCCGGTGGAGATCGGGATCCAAGTCACCCCCGACGAAGATGACCACCTGCTCTCACCCACGAAAGGCATCTGTCCCAAGCAGGAGAACATTGCAGGGCCGTGCAGGCCTGCCCAGCTGCCAGCGGTGGCCCCCATAGCTGCCTCCTCCCACCCTCACTCATCCGTGATCACTTCACCTCTGCGTGCCCTGGGCGCTCTCCCGCCCTGCCTCCCCCTGCCGTGCTGCAGCGCGCGCCCGGTCTCGGGTGACGGGACTCAGGGTGAGGGTCAGACGGAGGCTCCCTTTGGATGCCAGTGTCAGTTGTCAGG
Ig BCL11B AY752977 ATGTCCCGCCGCAAACAGGGCAACCCGCAGCACTTGTCCCAGAGGGAGCTCATCACCCCAGAGGCTGACCATGTGGAGGCCGCCATCCTCGAAGAAGACGAGGGTCTGGAGATAGAGGAGCCAAGTGGCCTGGGGCTGATGGTGGGTGGCCCCGACCCTGACCTGCTCACCTGTGGCCAGTGTCAAATGAACTTCCCCTTGGGGGACATCCTGGTTTTTATAGAGCACAAAAGGAAGCAGTGTGGCGGCAGCTTGGGTGCCTGCTATGACAAGGCCCTGGACAAGGACAGCCCGCCACCCTCCTCACGCTCCGAGCTCAGGAAAGTGTCCGAGCCGGTGGAGATCGGGATCCAAGTCACCCCCGACGAAGATGACCACCTGCTCTCACCCACGAAAGGCATCTGTCCCAAGCAGGAGAACATTGCAGG
Ig BCL11B AY752980 GGAATTCCAAGGTGGATTATGGACTTCTTCTAACTCCCATTGATAGTGCTTCTTACCAGGTGAAGGGAAGGGCTACTTTTTCCTAAAGGAGAAAAAAGCTTTCAGACAAAGCTCGTACCAACCCCTGAACTGCAAATTTGCTCAAGTGACCGTGCATACTTATATTCCTAATTTAAATGATTATTTATGTCAAACGCTCATTGTGAAACTTGAAAATGTTGTATTACATTACATCAAATAAAGTTTACTTGTAGCAGACAGAAAGAGAGAAAGAGAAAGAAAGAAAGGAAAGAAAGGAAGGAAAGAAGGAAAGAAAGAAAGAAAGAAAGAAAGGGA
Ig BCL11B AY752981 GCGCCGTATTAAACAGAATTGTGTGAATTGAAGGTCACCTGGACCACTCTTGGAAAATGCTCCCGACCCCCATGGGGTTCCTTCCAGAGAATTTGTGTTCTCTGTACCTGAGATCAAATGTGTGTCTAAGCAATTCTGGCCCCTGGCTCCCACCACCCTACCCTCTCCACAAAATAATAGACATTAGGGGAGGTAAGGGAACAGAAGAGGTCTCTTTGCAGATATTATATTTTTAAAAAATGGTTCTATGTAATAAGCAGCAGCTAAGGAGACAGAAAGACAGTAGATGAAGAGAGTGCCAATATCTTCCATGGGGAAAAATGAATGAACTGAAAGAGAATATTATTTTTCTAGAATACAGAAAGC
IKZF2 BCL11B 22867996 gaaaccgacgtgtaatcttaGgtccggaccccgcctcacc

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)