TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'ATF1'. The HGNC name for this gene is 'ATF1'.

12 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
EWSR1 ATF1 17188428 gcatttacaccactCtattcatttact
EWSR1 ATF1 17188428 ggctaacatatagtAgatgggacatat
EWSR1 ATF1 17188428 tagtgccttggaattgagAactatcacttaagtaa
EWSR1 ATF1 17188428 tattgcaggccactatCaagaccagtctcagaaaaag
EWSR1 ATF1 17188428 tgcttttggagacatcttaTctgaccacctgttgccgt
EWSR1 ATF1 18300800 ggtggaatgggAaaaattttg
EWSR1 ATF1 19561568 cggtggaatgggAaaaattttga
EWSR1 ATF1 19561568 cttgatctagTtgccattgc
EWSR1 ATF1 19561568 gggcagcagaTtgccattgc
EWSR1 ATF1 8401579 ATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGgAAAAATTTTGAAAGACTTATCTTCTGAAGATACACGGGGCAGAAAAGGAGA
EWSR1 ATF1 AF047022 AACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGATTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACAGGGACTTCAGACATTAACCATGACAAATTCAGGCAGTACTCAGCAAGGTACAACTATTCTTCAGTATGCACAGACCTCTGATGGACAGCAGATACTTGTGCCCAGCAATCAGGTGGTCGTACAAACTGCATCAGGAGATATGCCAACATATCAGATCCGAACTACACCTTCAGCTACTTCTCTGCCACAAACTGTGGTGATGACATCTCCTGTGACTCTCACCTCTCAGA
FUS ATF1 AJ295163 TATGGACAGCAGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGTTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACAGGGACTTCAGACATTAACCAT

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)