TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'ALK'. The HGNC name for this gene is 'ALK'.

50 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
ALK PTPN3 22334442 aggaggttacacaagggtgtTgtttcccccgtg
ATIC ALK 10702393 TACACACTGCAGCCCAAGCTTCCCATCACAgTGTACCGCCGGAAGCACCAGGAGCTGCAA
ATIC ALK 10706082 AAGGCGTATCTCAGATGCCCTTGAGATATGGAATGAACCCACATCAGACCCCTGCCCAGCTGTACACACTGCAGCCCAAGCTTCCCATCACAgTGTACCGCCGGAAGCACCAGGAGCTGCAAGCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCG
ATIC ALK 10706887 AAGCTTCCCATCACAgTGTACCGCCGGAAG
CARS ALK 12112524 AAGATTGCCCGAGAGCAAAAAgTGTACCGCCGGAAGCACCAGGAG
CARS ALK 13679433 GTGCGGAAGATTGCCCAGAGCAAAAAgTGTACCGCCGGAAGCACCAGGCGCTG
CARS ALK 13679433 TGCCCACTGCTTTCTGCACATTGCCTCatAATTATTTTCCATATATCTGATTTTTA
CLTC ALK 10807789 AAAGAAGAAGAACAAGCTACAGAGACACAACCCATTGTTTATgTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAG
CLTC ALK 11485898 CAACCCATTGTTTATgTGTACCGCCGGAAGCACCAGGAGCTG
CLTC ALK 12112524 GAGACACAACCCATTGTTTATgTGTACCGCCGGAAGCACCAGGAG
CLTC ALK 12750159 ACACAACCCATTGTTTATGATGGGGTCTCGTCTGTCACCCAGGCTGGAGTGCAGTGGCGTGATCTCGGCTCACTGCAACCTtCAAGGGCCAGGCTGCCAGGCCATGTTGCAGCTGACCACCCACCTGCAGTGTACCGCCGGAAGCACCAG
CLTC ALK 12750159 ATGTCTTTTTTTTTCCCCAAgATGGGGTCTCGTCTGTCAC
CLTC ALK 12920229 ACACAACCCATTGTTTATgTGTACCGCCGGAAGCACCAGG
CLTC ALK 15492998 GCTCCTGGTGCTTCCGGCGGTAGaCATAAACAATGGGTTGTGT
EML4 ALK 17625570 ATATAATGTCTAACTCGGGAGACTATGAAATATTGTACTtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgc
EML4 ALK 17625570 CTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAGtGTACcgccggaagcaccaggagctgcaagccatgcagatggagctgcag
EML4 ALK 18083107 tcgcgaaaaaaacagccaagTgtaccgccggaagcaccag
EML4 ALK 18593892 catcatcaaccaagTgtaccgccggaagcaccaggagctg
EML4 ALK 18593892 cgcgaaaaaaacagccaagTgtaccgccggaa
EML4 ALK 19383809 ctgaaagagaaatagagCaccaggagc
EML4 ALK 19737969 acctggtaacAcaattttgt
EML4 ALK 19737969 ataaactcatGtgttggggg
EML4 ALK 19737969 tatgatagatCacattggta
EML4 ALK 19737969 tggagtgagaCtcctctgat
EML4 ALK 19737969 tggtatcttcCagacaccaa
KIF5B ALK 21225871 ggcaaccactTctcgctgat
KIF5B ALK 21225871 tgatgtaaagCaccaggagc
MSN ALK 15297972 AGAAGGTAAGCACAGCAGGCAGCTACTGGAGTTCTCtCAAGCTGAGCAAGTCCGCACCTCGCAAGCTGAGCA
MSN ALK 15297972 ATGGCCCGACAGAAGAAGGAGAGTGAGGCTGTGGAGTGGCAGCAGAAGCAGGCAGCATGGGAGAAGGCACTCATGGTTTCGTCAAATACTTACTGGAGTTCTCtCAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGC
MSN ALK AF295078 ACCTGGTGCCTGCCTCTTGCCAGACCGTTCTAGGCATATACAGGATGCCACAGTTTAACTGGTCTCACTGACAGTCTTTCTCTCCTTCTGTCACTGGACAGCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAA
MSN ALK AF295079 AGTGCTTCAAGGGCCAGGCTGCCAGGCCATGTTGCAGCTGACGCTGAGCTGAAGACTGCCATGAGTACACCTCATGTGGCAGAGCCTGCTGAGAATGAGCAGGATGAGCAGGATGAGAATGGGGCAGAGGCTAGTGCTGACCTACGGGCTGATGCA
MSN ALK AF295356 AGAAGAAGGAGAGTGAGGCTGTGGAGTGGCAGCAGAAgCAGGAGCTGCAAGCCATGCAGATGGAGCTGCA
MYH9 ALK 12800156 CGGGACGAAGCCATCAAACAGCTGCGGAAGCTGCAGGTcCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGC
NPM1 ALK 20207848 cacttagtagTgtaccgccgg
NPM1 ALK AF032882 GTTAGGGAAACAGGGCAGGAGTTACCATCCCTGCCTACAGAGAGGGAAACTGCAGTCCAAAGAGGTCCTGTGACCTGGTCCTCATGGCTCAGCTTGTAAGTAACAAGAGGCGGAATTAGAGCACAGATCCCCAGACACCAATTCAGATCCTAGGAAGTCTCAGTTTTTAGAGTATTTACTATCAGTGTTCTTTTTTTTTCTGACTTCTTGCTGCTTGAGTTTTATAATGTCTAATAAATTGTATTTTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGA
NPM1 ALK S82725 TCTCAGTTTTTAGAGTCATTTACTATCAGTGTTCTTTTTTTTCTGACCCCTGGGCCAGCTGCACCCTCAAATCCACTGCTGTGATTGCACTGAAGCTGCCCTACCCAATGGCTGAGCACAGCAGAAATACTAAGGCAGGC
RANBP2 ALK 12661011 CTGTTCCTGTGTTCATAGATTCTTTTTCCTTAATAAAAGTAAACATATATCAAGATGGTCCTTGTTTTTTAAAAaACTTGCAACACAGTCTGCTGGTTCACCCAGCCTTCCCTGGCTCCCTCCCCATTTCCTCTCATGGGCATTTCTCCT
RANBP2 ALK 12661011 GGAGTTTGGACCTGAATCATACTGGGTTTTTAAGTTCTGCTCTATCACTTACTATAATAGCTGTGTAAGTTAaCCTGGCTCCCTCCCCATTTCCTCTCATGGGCATTTCTCCTAATAAAATCTGCAGACCGTATTGGGTCTAATCCCATC
RANBP2 ALK 12661011 GGGGCTCCACTAACAgTGTACCGCCGGAAG
RNF213 ALK 12112524 AACGTGAAACATCTGATACAAgTGTACCGCCGGAAGCACCAGGAG
SEC31A ALK 16161041 TTTAACCTGGCTGAGAAACAGAGtcTTTAATCATTTTATTAGTATTTC
SEC31A ALK 20207848 gcgtcccaaagaacagTgtaccgccgg
SQSTM1 ALK 21134980 agctgcccttagccctctggTgtaccgccggaagcaccag
TFG ALK AF390891 TTAGTATAATAGATAAGTAATGAACCTTGGGAATTGAAAATCATTTCATGAATAATTACATAGTGTTGGAAGTATTTTCAGATCAGGGGGTTGGGGAAGCTCCTTCAGTGTCCATCACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCTTCCACCGGCGCAGCTCCTGTTTGGCTCCCACCCTATGTA
TFG ALK AF390892 TTATTTTGGCAATCATCAGTCTCTCTTGCATTACCACTATTATATCCTAGTTTAGGTTCTTATTAATACTTGGACTGTCAGCTGTCAACTGTGCCTAATACTGTGGTAATTAGAGCTCTTTAGGATTTTTCAAAACCATTTTATGTTGGTGAATTCATTTCATTGACAACCCTAGAGGGTGGGGAGTGGCAGTGGTTAGGGAAACAGGGC
TFG ALK AF390893 GCTTCCTCCTCCTCAGCAGCTCACCCACCAGGCGTTCAGCCACAGCAGCCACCATATACAGGAGCTCAGACTCAAGCAGGTCAGATTGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGC
TPM3 ALK AF112866 ACTCAAAACATGGCTAGTGTGGCTGAGGGGCTAAAATTTAATTGTATTTCATTGTAGTTCATTTAAATTTGGCTACCTGTGGCTAGTGGCTATTATATTGGACAATGCATTTCTAAATATTCAGATCCTGGGCAGAAGTTGGCTTTGACATGAAGAAAGACTTCTTAGAAAGGAAGGAAGTAGACCGgGGGAACTGAGCACATAGCGGGTGACTCATTTGCCCTGGCCCATGTGTTGGGGGGCTGGGCTTTACACACAGAATCTACCCACTGAATCACAA
TPM4 ALK AF186110 AAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACA
TPM4 ALK AF310722 TGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGA
TPM4 ALK AF362887 CTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCTCCGGAAGCACCAAGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCCTCGAC

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)