TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'AFF3'. The HGNC name for this gene is 'AFF3'.

4 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
AFF3 BCL2 18622426 AAAAGGAACGGGAGCTGAGAGcatcacagaggaagtagactgatattaac
KMT2A AFF3 12661012 TAGCAGATGGAGTCCACAGGAATCAGAGTGGACTTTAAGgAGATGACCTGGCTTCCACCACTTTCTGCTATTCAAGCACC
KMT2A AFF3 AF422798 GAGGATCCTGCCCCAAAGAAAAGCAGTAGTGAGCCTCCTCCACGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGGGCCTGAATCCAAACAGGCCACCACTCCAGCTTCCAGGAAGTCAAGCAAGCAGGTCTCCCAGCCAGCACTGGTCATCCCGCCTCAGCCACCTACTACAGGACCGCCAAGAAAAGAAGTTCCCAAAACCACTCCTAGTGAGCCCAAGAAAAAGCAGCCTCCACCACCAGAATCAGGTCCAGAGCAGAGCAAACAGAAAAAAGTGGCTCCCCGCCCAAGTATCCCTGTAAAACAAAAACCAAAAGAAAAGGAGATGACCTGGCTTCCACCACTTTCTGCTATTCAAGCACCTGGCAAAGTGGAACCAACCAAATTTCCATTTCCAAATAAGGACTCTCAGCTTGTATCCTCTGGACACAATAATCCAAAGAAAGGTGATGCAGAGCCAGAGAGTCCAGACAATGGCA
RUNX1 AFF3 17968322 AGTCGACTCTCAAagaaaggtgatgc

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)